D. Yu. Ryazantsev, E. M. Chudinova, L. Yu. Kokaeva, S. N. Elansky, P. N. Balabko, G. L. Belova, S. K. Zavriev
The phytopathogenic fungus Colletotrichum coccodes causes dangerous diseases in potatoes and tomatoes known as anthracnose and tuber black spot. By their morphological characteristics, they are often difficult to distinguish from diseases caused by other microorganisms; on green tomato fruits, the disease can be asymptomatic, manifesting itself only on ripe red fruits. For quick and accurate diagnosis of the pathogen, a real-time PCR test system is offered. To develop a test system, the nucleotide sequence of the glycerol triphosphate dehydrogenase gene of 45 C. coccodes strains isolated from potato tubers in different regions of Russia was determined.
Based on the results obtained and analysis of similar sequences of other species available in the GenBank database, the species-specific primers and probe for C. coccodes were designed. To check the specificity of the created test system, PCR was carried out with DNA isolated from pure cultures of 15 different species of parasitic and saprotrophic fungi associated with tomato and potato plants (Fusarium oxysporum, F. verticillium, Phomopsis phaseoli, Alternaria alternata, Helminthosporium solani, Colletotrichum coccodes Phellinus ferrugineovelutinus, Stemphylium vesicarium, Helminthosporium solani, Phomopsis phaseoli, Neonectria radicicola, Rhizoctonia solani, Penicillium sp., Cladosporium fulvum, C. cladosporioides). The presence of Colletotrichum coccodes DNA was determined at a threshold cycle of 20–27, while other species were detected after 40 cycles or were not detected. The test system makes it possible to reliably detect C. coccodes DNA concentrations in excess of 0.01 ng / mm3 in the analyzed PCR mixture. Using the developed test system, the presence of C. coccodes in tomato leaves with symptoms of fungal diseases and in potato tubers without external symptoms of the disease was investigated. Leaves with symptoms of fungal infection were collected from two different fields in the Krasnodar Territory, tubers - from fields in the Kostroma, Moscow, Kaluga, Nizhny Novgorod regions. One tomato leaf containing C. coccodes DNA was found in Krasnodar Territory; significant presence of DNA of this pathogen was detected in 5 samples of tubers grown in the Kostroma, Moscow, Kaluga regions.
Introduction
Mushrooms of the genus Colletotrichum are dangerous phytopathogens affecting cereals, vegetables, herbs, perennial fruit and berry plants. One of the ubiquitous species of this genus, Colletotrichum coccodes (Wallr).
Hughes, is the causative agent of anthracnose and black spot of potatoes and tomatoes, and causes diseases of a number of other plants of the Solanaceae family, incl. weeds (Dillard, 1992). C. coccodes affects all underground parts of the plant, stem bases, leaves, and fruits (Andrivon et al., 1998; Johnson, 1994). On the peel of infected potato tubers, the development of gray spots with indistinctly pronounced edges is observed, on which black dots of sporulation and microsclerotia are clearly visible. During storage, ulcers with softened contents can form in the pulp of tubers, i.e. the disease enters the anthracnose phase, which, however, is extremely rare.
At the same time, the symptoms of anthracnose (skin ulcers with small black dots) are typical of tomato fruits. On leaves, the symptoms of C. coccodes appear as dark brown spots, usually bordered with yellow tissue (Johnson, 1994).
The development of black spot on the tubers spoils their appearance, which is especially pronounced when selling washed red-skinned potatoes. Peel exfoliation leads to excess evaporation and increased storage losses (Hunger, McIntyre, 1979). Damage to other plant organs leads to loss of yield, which was noted in both open and closed ground (Johnson, 1994; Tsror et al., 1999). Diseases caused by C. coccodes are common in almost all potato-producing regions of the world, including Russia (Leesa, Hilton, 2003; Belov et al, 2018). The control of these diseases is difficult due to the insufficient effectiveness of existing fungicides against C. coccodes and the lack of resistant varieties (Read, Hide, 1995).
The C. coccodes inoculum can persist in seed tubers (Read, Hide, 1988; Johnson et al., 1997), tomato seeds (Ben-Daniel et al., 2010), survive for a long time in soil, on plant debris (Dillard, 1990 ; Dillard and Cobb, 1993) and in weeds (Raid and Pennypacker, 1987). The works of a number of authors (Read, Hide, 1988; Barkdoll, Davis, 1992; Johnson et al., 1997; Dillard, Cobb, 1993) have shown that the development of the disease in potatoes and tomatoes largely depends on the presence of inoculum in seed and soil. Therefore, to minimize losses from the disease, it is necessary to diagnose (including quantitative) the propagules of the fungus in the seed material, in the soil, in the seed potato tubers and tomato seeds laid for storage. Morphological diagnostics in soil and plant material can be carried out only by the presence of microsclerotia, which, however, are also found in other types of fungi.
The symptoms on the tubers are very similar to the silver scab caused by the Helminthosporium solani fungus. Isolation of Colletotrichum coccodes and Helminthosporium solani into a pure culture is rather difficult and takes a long time due to the slow growth on a nutrient medium. To quickly identify Colletotrichum coccodes, it is necessary to use instrumental diagnostic methods. The most convenient method is polymerase chain reaction (PCR) and its modification - real-time PCR. Currently, a test system developed by British researchers (Cullen et al., 2002) for the ITS1 region of rDNA is used in Europe and the United States. Its use has shown good results in the analysis of Russian isolates (Belov et al, 2018). However, C. coccodes is highly variable and its detection from a single DNA sequence can lead to false negative results. For a more reliable diagnosis, it is necessary to analyze several species-specific DNA sequences, in connection with which we have developed an original test system that allows us to identify C. coccodes by the sequence of the glyceraldehyde-3-phosphate dehydrogenase gene.
Materials and methods
To assess the effectiveness and specificity of the created test systems, we used pure cultures of 15 species of fungi isolated by the authors from diseased samples of tomato leaves and fruits, potato tubers (Table 1). For isolation, the organs of plants with symptoms of fungal infection were taken, no more than one organ per bush.
A slice of a tuber with a peel, a slice of a tomato fruit, and an affected leaf were placed under a binocular microscope, after which mycelium, spores, or a piece of tissue were transferred onto an agar medium (wort agar) in a Petri dish with a sharpened dissecting needle. The isolates were stored on agar slant in test tubes at 4 ° C.
Samples of tomato leaves with symptoms of fungal diseases intended for analysis immediately after collection (in the field) were placed in 70% ethyl alcohol in which they were stored until DNA isolation. Potato tubers were delivered to the laboratory, peeled (2 × 1 cm piece) from them, and frozen at –20 ° С. Stored frozen until DNA isolation.
Pure cultures of fungi for DNA isolation were grown in liquid pea medium. The mycelium of the fungus was removed from the liquid medium, dried on filter paper, frozen in liquid nitrogen, homogenized, incubated in CTAB buffer, purified with chloroform, precipitated with a mixture of isopropanol and 0.5 M potassium acetate, washed twice with 2% alcohol. The resulting DNA was dissolved in deionized water and stored at –70 ° С (Kutuzova et al., 20). DNA concentration was measured using an HS DNA quantification kit for double stranded DNA on Qubit 2017 (Qiagen, Germany). The alcoholized and frozen samples were triturated in liquid nitrogen, followed by DNA isolation as described above (for the mycelium of pure fungal cultures).
Table 1. Origin of the used fungal strains
Mushroom name | Plant, organ | Place of selection |
---|---|---|
Colletotrichum coccodes 1, C. coccodes 2, C. coccodes 3, Ilyonectria crassa, Rhizoctonia solani | potato tuber | Kostroma region, potato tubers of the 1st field generation, cultivar Red Scarlett |
Colletotrichum coccodes 4 | potato sheet | Rep. Mari El, Yoshkar-Ola |
Helminthosporium solani | potato tuber | Magadan region, pos. Tent, potato tuber |
Cladosporium fulvum | tomato leaf | Moscow region, large-fruited tomato |
Alternaria tomatophila | tomato fruit | handed over by the staff of the laboratory of mycology and phytopathology of the All-Russian Research Institute of Plant Protection |
Fusarium verticillium, Phomopsisphaseoli, Alternaria alternata, Phellinus ferrugineovelutinus, Stemphylium vesicarium, Cladosporium cladosporioides, Acrodontium luzulae, Penicillium sp. | tomato fruit | Krasnodar Territory, Krymsky district, grade Cream |
Fusarium oxysporum | wheat root | Moscow region. |
PCR was carried out on a DTprime amplifier (DNA-Technology). For PCR, original primers and a probe for the species-specific region of the glycerol triphosphate dehydrogenase gene were used: forward primer Coc70gdf –TCATGATATCATTTCTCTCACGGCA, reverse primer Coc280gdr - TACTTGAGCATGTAGGCCTGGGT1). The primers amplify a 213 bp region.
The reaction took 50 ng of total DNA (when analyzing leaves and tubers) and 10 ng (when analyzing DNA of pure fungal cultures). The reaction mixture (35 μl) was separated by a paraffin layer into two parts: the lower one (20 μl) contained 2 μl of 10 × reaction buffer (750 mM Tris-HCl, pH 8.8; 200 mM (NH4) 2SO4; 25 mM MgCl2; 0.1% Tween- 20), 0.5 mM of each deoxynucleotide triphosphate, 7 pmol of each primer, and 4 pmol of a hydrolyzable fluorescent probe; the upper one contained 1 μl of 10 × PCR buffer and 1 U of Taq polymerase.
Separation of the mixture with paraffin allows the tubes to be stored for a long time at a temperature of 5 ° C and to provide a hot start for PCR after heating them for 10 min at a temperature above 80 ° C. PCR was performed according to the following program: 94.0 ° C - 90 s (1 cycle); 94.0 ° C - 30 s; 64.0 ° C - 15 s (5 cycles); 94.0 ° C - 10 s; 64.0 ° C - 15 s (45 cycles); 10.0 ° C - storage.
Results and discussion
The sequences of the glycerol triphosphate dehydrogenase gene were determined in 45 strains isolated from leaves, stems, potato tubers, and tomato fruits (Kutuzova, 2018) in different regions of Russia. The studied sequences of all strains were divided into 2 groups differing in two nucleotides. The nucleotide sequences of representatives of both groups under the numbers KY496634 and KY496635 have been deposited in GenBank.
The primers coc70gdf, coc280gdr and the cocgdz probe designed on their basis were checked using the BLAST program (www.ncbi.nlm.nih.gov/blast) on all sequences of the glycerol triphosphate dehydrogenase gene of species of the genus Colletotrichum and other organisms available in the GenBank database.
No DNA regions of other organisms highly homologous to primers and probe were found.
The sensitivity of the test system was checked using samples with different concentrations of C. coccodes DNA, DNA of a potato leaf infected with anthracnose (collected in 2017 in Mari El, variety Red Scarlett), and peel of tubers affected by black spot (collected in Kostroma region, variety Red Scarlett, Table 2). To confirm the presence of DNA in tubers and potato leaves, C. coccodes strains were isolated from them into pure cultures.
The results of the sensitivity analysis of the test system show that it can be used to successfully diagnose the presence of C. coccodes DNA in a sample when its total content in the PCR mixture is more than 0.05 ng. This is quite sufficient for detection, since one sclerotia contains on average 0.131 ng, and one spore contains about 0.04 ng of DNA (Cullen et al., 2002). The test system developed by the English group (Cullen et al., 2002) showed a similar sensitivity (threshold cycle 34 at 0.05 ng DNA and 37 at 0.005 ng).
Analysis of natural samples containing C. coccodes in all cases made it possible to reliably reveal its presence in the sample (Table 2). The proposed method for DNA isolation was also applicable to the analysis of natural plant samples.
Table 2. Determination of the sensitivity of the proposed test system for the identification of Colletotrichum coccodes for real-time PCR
Sample | The amount of DNA in the sample *, ng | Threshold cycle | C. coccodes detection |
---|---|---|---|
Mycelium Colletotrichum coccodes | 50 | 21.3 | + |
5 | 25.7 | + | |
0.5 | 29,7 | + | |
0.05 | 33.5 | + | |
0.005 | 40 | - | |
0.0005 | 42.8 | - | |
0.00005 | - | ||
Tuber peel 1 | 50 | 32 | + |
Tuber peel 2 | 50 | 30 | + |
Tuber peel 3 | 50 | 31.5 | + |
Potato leaf | 50 | 29.5 | + |
Note. * In a mixture of PCR products.
The specificity of the test system was tested on DNA samples extracted from 15 species of fungi. All strains of fungi were isolated by the authors from affected and healthy fruits and leaves of tomato, potato tubers; one strain was isolated from wheat root (Table 1). Among those isolated from the surface of the fruit, there are also species that are not pathogenic for tomato (for example, Phellinus ferrugineovelutinus).
Studies have shown that C. coccodes DNA was detected at a threshold cycle of 20–27, while other fungal species were not detected or gave a signal after cycle 40, which can be attributed to a nonspecific noise effect (Table 3).
Table 3. Testing the test system for various types of mushrooms
Mushroom name | Threshold cycle |
Colletotrichum coccocodes 1 | 20.9 |
C. coccodes 2 | 22.6 |
C. coccodes 3 | 23 |
C. coccodes 4 | 22 |
Fusarium oxysporum | > 40 |
F. verticalillium | > 40 |
Rhizoctonia solani | > 40 |
Phomopsis phaseoli | > 40 |
Alternaria alternata | > 40 |
A. tomatophila | > 40 |
Helminthosporium solani | > 40 |
Phellinus ferrugineovelutinus | > 40 |
Stemphylium vesicarium | > 40 |
Ilyonectria crassa | > 40 |
Cladosporium cladosporioides | > 40 |
C. fulvum | > 40 |
Acrodontium luzulae | > 40 |
Penicillium sp. | > 40 |
Note. * The amount of DNA in all samples was 10 ng.
The developed test system was used to identify C. coccodes in tomato leaf samples with symptoms of necrotrophic pathogens and seed potato tubers without visible symptoms. For the study, we took seed tubers of different varieties grown in the Kostroma, Moscow, Kaluga, Nizhny Novgorod regions. The presence of C. coccodes DNA was considered significant in the samples, in the analysis of which the threshold cycle did not exceed 35. This threshold value was selected based on the reliable determination of 0.05 ng of C. coccodes DNA (threshold cycle 33.5, Table 2) and the fact that threshold cycles above 40, nonspecific DNA of some other species of fungi was diagnosed. With this approach, the significant presence of C. coccodes DNA was detected in 5 samples of tubers grown in the Kostroma, Moscow, Kaluga regions and in one tomato leaf from the Yeisk region of Krasnodar region (Tables 4, 5).
Table 4. Detection of Colletotrichum coccodes on potato tubers *
Sample number | Variety of potatoes | Place of growth | C. coccodes detection | Threshold cycle |
---|---|---|---|---|
1 | Red Scarlet | Kostroma region | + | 35 |
2 | + | 35 | ||
3 | - | 38 | ||
4 | Sante | Moscow region. | + | 34 |
5 | - | |||
6 | - | 41 | ||
7 | - | 41.8 | ||
8 | + | 30 | ||
9 | Zhukovsky early | Moscow region. | - | 40.5 |
10 | - | 40.6 | ||
11 | - | |||
12 | Molly | Kaluga region | + | 34.3 |
13 | - | 38.4 | ||
14 | Fantasy | Kaluga region | - | |
15 | Gala | Nizhny Novgorod region. | - | |
16 | - |
Note. * The amount of DNA in all samples was 50 ng.
Table 5. Detection of Colletotrichum coccodes on tomato leaves *
Sample number | Place of growth | C. coccodes detection | Threshold cycle |
---|---|---|---|
1 | Krasnodar Territory, Crimean District | - | |
2 | - | ||
3 | - | ||
4 | - | 45 | |
5 | - | ||
6 | - | ||
7 | - | ||
8 | - | ||
9 | Krasnodar Territory, Yeisk District | - | 39.2 |
10 | - | 40.8 | |
11 | - | ||
12 | - | 41.6 | |
13 | - | 40 | |
14 | - | 41 | |
15 | - | 41.9 | |
16 | - | ||
17 | - | ||
18 | - | 40.3 | |
19 | - | ||
20 | - | ||
21 | + | 34.5 | |
22 | - | ||
23 | - |
* The amount of DNA in all samples was 50 ng.
The test system created by us is not inferior to that developed by British researchers (Cullen et al., 2002) in sensitivity and specificity and is suitable for the analysis of plant samples. Its application for the analysis of seed tubers made it possible to identify C. coccodes DNA in tubers without external signs of damage and to successfully analyze the infection of leaves.
To date, no analysis of potato tubers for the infestation of C. coccodes has been carried out in Russia. Our first study showed that out of 16 tested seed tubers grown in different regions of the Russian Federation, 5 contain C. coccodes. This shows that black spot of potato tubers is a common potato disease in Russia, and its role in reducing the volume and quality of the potato crop is underestimated.
Analysis of tomato leaves revealed a significant presence of C. coccodes DNA in one leaf from the Yeisk district of Krasnodar Territory. Earlier, when examining tomato fields in southern Russia using the British test system (Cullen et al., 2002), leaves containing C. coccodes were identified, and in some fields a high proportion of leaves infected with C. coccodes was found (Belov et al., 2018). In the Krasnodar and Primorsky Territories, the Moscow Region, we found tomato fruits, from which we managed to isolate pure cultures of C. coccodes. It is possible that C. coccodes is much more widespread on tomato in Russia than is now believed, and its harmfulness is also underestimated.
Thus, to date, enough information has accumulated on the widespread distribution of C. coccodes on potatoes and tomatoes.
To better understand the role of this fungus in the development of potato and tomato diseases, extensive monitoring of its prevalence in Russia, study of the role of soil and seed infection, and the role of black spot in losses during storage is required. The use of PCR diagnostics can significantly facilitate this work, and the simultaneous use of both test systems will significantly increase the accuracy of the analysis.
This work was supported by the Russian Science Foundation grant no. 18-76-00009.
The article was published in the journal Mycology and Phytopathology (volume 54, No. 1, 2020).