S.N. Elansky, L.Yu. Kokaeva, N.V. Statsyuk, Yu.T. Dyakov
Introduction
Oomycete Phytophthora infestans (Mont.) De Bary, the causative agent of late blight, the most economically important disease of potatoes and tomatoes, has attracted close attention of researchers from different countries for more than a century and a half. Suddenly appearing in Europe in the middle of the XNUMXth century, it caused a potato epidemic that has remained in the memory of many generations.
Until now, it is often called the "mushroom of the Irish hunger". Almost a hundred years after the first epidemics, wild Mexican potato species resistant to late blight were discovered, methods of crossing them with cultivated potatoes were developed (Muller, 1935), and the first late blight-resistant varieties were obtained (Pushkarev, 1937). However, soon after the start of their commercial cultivation, races of the late blight pathogen that were virulent to resistant varieties accumulated. and the introduction of new resistance genes from wild Mexican potatoes into varieties began to rapidly lose effectiveness.
Failures with the use of monogenic (vertical) resistance forced breeders to look for more complex ways of exploiting nonspecific polygenic (horizontal) resistance. In recent years, highly aggressive races have begun to accumulate in individual populations of the parasite, causing erosion of even nonspecific resistance. The advent of fungicide-resistant strains has caused problems in the use of potato protection chemicals.
Due to the significant differences between oomycetes and fungi in chemical composition, ultrastructure, and metabolism, fungicides, especially systemic ones used to protect plants from many fungal diseases, are ineffective against oomycetes.
Therefore, in the chemical protection against late blight, multiple (up to 12 times per season or more) spraying with contact preparations of a wide spectrum of action was used. A revolutionary step was the use of phenylamides, which are toxic to oomycetes and spread systemically in plants. However, their widespread use quickly led to the accumulation of resistant strains in fungal populations (Davidse et al., 1981), which significantly complicated plant protection. P. infestans is practically the only parasite of the temperate zone, the harm from which in organic farming cannot be neutralized without the use of chemical means of protection (Van Bruggen, 1995).
The above explains the enormous attention paid by researchers from different countries to the study of P. infestans populations, the dynamics of their abundance and genetic composition, as well as the genetic mechanisms of variability.
Life cycle of R. INFESTANS
Oomycete Phytophthora infestans develops an intercellular mycelium with haustoria inside potato leaves. Feeding on leaf tissues, it causes the formation of dark spots, which turn black and rot in wet weather. With a strong defeat, the entire leaf dies. After a period of feeding, outgrowths are formed on the mycelium - sporangiophores - which grow outward through the stomata. In wet weather, they form a white bloom around the spots on the underside of the leaves. At the ends of the sporangiophores, lemon-shaped zoosporangia are formed, which break off and are carried by spray of rain (Fig. 1). Getting into drops of water on the surface of a potato leaf, sporangia germinate with 6-8 zoospores, which, after a period of movement, are rounded, covered with a shell and germinate with a sprout tube. The sprout penetrates the leaf tissue through the stomata. Under certain conditions, sporangia can grow in a growth tube directly into leaf tissue. Under favorable conditions, the time from infection to the formation of new sporulation is only 3-4 days.
Once on the ground and filtered through the soil, sporangia are capable of infecting tubers. Severely affected tubers rot during storage; in the weakly affected, the infection may persist until the next season. In addition, the causative agent of late blight can persist in the winter in the form of oospores (thick-walled resting sexual spores) in the soil on plant debris and on tomato seeds. Oospores are formed on living organs of plants when strains of different types of mating meet with excessive moisture. In spring, asexual sporulation is formed on planted infected tubers and on plant residues with oospores; zoospores enter the soil and cause infection of the lower leaves of plants. In some cases, the mycelium can grow from the infected tuber to the green part of the plant and usually appear in the upper part of the stem.
A significant difference between oomycetes and most fungi lies in the predominance of diplophase in their life cycle with gametic meiosis and germination of zygotes (oospores) without reductive nuclear fission. This feature, plus dipolar heterotallism replacing bisexuality, would seem to make it possible to apply to oomycetes the approaches developed for studying populations of higher eukaryotes (analysis of panmixia and subdivision of populations, intra- and interpopulation gene flows, etc.). However, three factors do not allow completely transferring these approaches when studying the P. infestans populations.
1. Along with hybrid oospores, self-fertile and parthenogenetic oospores are formed in populations (Fife and Shaw, 1992; Anikina et al., 1997a; Savenkova, Cherepnikoba-Anirina, 2002; Smirnov, 2003), and the frequency of their formation may be sufficient to influence on the test results.
2. The sexual process in P. infestans makes an insignificant contribution to the dynamics of the population size, because the fungus reproduces mainly by vegetative spores, forming for more than 90% of the results of the analysis of the mating type by the traditional method on a nutrient medium ... the growing season several generations of asexual sporulation (polycyclic disease development). Oospores play an important role in the preservation of the organism during the period when there are no green plants (in winter) and in the primary infection of seedlings. Then, during the summer, clonal reproduction and an increase or, conversely, a decrease in the number of individual clones that have arisen as a result of sexual recombination occurs, which is mainly determined by the selection of the more adapted. Therefore, the ratio of individual clones in a population at the beginning and end of epiphytotics can be completely different.
3. The described cycle is characteristic of the native populations of P. infestans in their homeland, Central America. In other areas of the world, the sexual process was not known for more than 100 years; the vegetative mycelium in infected potato tubers was the wintering stage. The life cycle was completely agamic, and the spread was focal in nature: the infection from single infected planted tubers passed to the leaves, forming primary foci of the disease, which could merge with the massive development of the disease.
Thus, in some regions there may be an alternation of sexual and asexual cycles, while in others - only asexual cycle.
Origin of P. INFESTANS
P. infestans appeared in Europe at the end of the first half of the 1991th century. Since the potato is native to the northeastern part of South America, it was assumed that the parasite was brought from there to Europe during the boom of Chilean saltpeter. However, studies carried out at the Rockefeller Center potato station in the Toluca Valley, Mexico forced this point of view to be reconsidered (Niederhauser, 1993, XNUMX).
1. In the Toluca Valley, local tuberous potato species (Solanum demissum, S. bulbocastanum, etc.) have different sets of genes for vertical resistance combined with a high level of nonspecific resistance, which indicates a long co-evolution with the parasite. South American species, including crop potatoes, lack resistance genes.
2. In the Toluca Valley, isolates with mating types A1 and A2 are found, as a result of which the interbred population of P. infestans is widespread; while in the homeland of the cultivated potato, South America, the parasite spreads clonally.
3. In the Toluca Valley, there are annual severe epidemics of late blight. Therefore, among North American researchers (Cornell University), the opinion about Mesoamerica (Central America) as the birthplace of potato phytophthora is established (Goodwin et al., 1994).
South American researchers do not share this opinion. They believe that the cultivated potato and its parasite P. infestans have a common homeland - the South American Andes. They supported their point of view by molecular studies on the analysis of DNA polymorphisms of the mitochondrial genome (mtDNA) and nuclear genes RAS and β-tubulin (Gomez-Alpizar et al., 2007). They showed that the strains collected from different parts of the world descended from three divergent ancestral lines that (all three) are found in the South American Andes. Andean haplotypes are descendants of two lines: isolates of the oldest mtDNA lineage are found on wild Solanaceae from the section Anarrhicomenum in Ecuador, while isolates of the second line are common on potatoes, tomatoes, and wild nightshades. In Toluca, even rare haplotypes are descended from only one lineage, with the genetic variability of the Toluca strains (low allelic frequency of some variable sites) suggests a strong founder effect due to recent drift.
In addition, a new species P. andina was found in the Andes, morphologically and genetically similar to P. infestans, which, according to the authors, points to the Andes as a hot spot of speciation in the genus Phytophthora. Finally, in Europe and the United States, P. infestans populations include both Andean lineages, while in Toluca only one.
This publication prompted a response from a group of researchers from different countries, who did a lot of experimental work to revise the previously performed study (Goss et al., 2014). In this work, firstly, more informative microsatellite DNA sequences were used to study DNA polymorphisms; secondly, for the analysis of clustering, migration paths, time divergence of populations, etc. more advanced models were used (F-statistics, Bayesian approximations, etc.) and, thirdly, a comparison was used not only with the Andean species P. andina, in which a hybrid nature was established (P. infestans x Phytophthora sp.) but also with the Mexican endemic species P. mirabilis, P. Ipomoeae, and Phytophthora phaseoli, which are genetically close P. infestans included in the same clade (Kroon et al., 2012). As a result of these analyzes, it was unambiguously shown that the root part of the phylogenetic tree of all species of the genus Phytophthora taken into the study, except for the hybrid P. andina, belongs to Mexican strains, and the migration flow has the direction Mexico - Andes, and not vice versa, and its beginning coincides with the European colonization of the New World (300-600 years ago). Thus, the emergence of the P. infestans species specialized for the defeat of potatoes occurred in the secondary genetic center of the formation of tuberous solanaceous plants, i.e. in Central America.
Genome of P. INFESTANS
In 2009, an international team of scientists sequenced the complete P infestans genome (Haas et al, 2009), the size of which was 240 MB. This is several times more than in closely related species P. sojae (95 Mb), causing root rot of soybeans, and P. Ramorum (65 Mb), affecting such valuable tree species as oak, beech, and some others. The data obtained showed that the genome contains a large number of copies of repeated sequences - 74%. The genome contains 17797 protein-coding genes, most of which are genes involved in cellular processes, including DNA replication, transcription and translation of proteins.
A comparison of genomes of the genus Phytophthora revealed an unusual organization of the genome, consisting of blocks of sequences of conserved genes, in which the gene density is relatively high, and the content of repeated sequences is relatively low, and individual regions with non-conserved gene sequences, with a low gene density and a high content of repeating regions. Conservative blocks account for 70% (12440) of all P. infestans protein-coding genes. Within conservative blocks, genes are usually closely spaced with an average intergenic distance of 604 bp. In areas between conservative blocks, the intergenic distance is greater (3700 bp) due to an increase in the density of repeating elements. Rapidly evolving effector secretory genes are located in gene-poor regions.
Sequence analysis of the P. Infestans genome showed that approximately one third of the genome belongs to transposable elements. The P. infestans genome contains significantly more different families of transposons than other known genomes. Most of P. infestans transposons belong to the Gypsy family.
A large number of specific gene families involved in pathogenesis have been identified in the P. infestans genome. A significant part of them encode effector proteins that change the physiology of the host plant and contribute to its infection. They belong to two broad categories: apoplastic effectors, which act in the intercellular spaces (apoplasts), and cytoplasmic effectors, which enter cells via haustoria. Apoplastic effectors include secreted hydrolytic enzymes such as proteases, lipases and glycosylases that destroy plant cells; inhibitors of host plant defense enzymes; and necrotizing toxins such as Nep1-like proteins (NPLs) and Pcf-like small cysteine-rich proteins (SCRs).
P. infestans effector genes are numerous and usually larger than nonpathogenic genes. The most famous are the cytoplasmic effectors RXLR and Crinkler (CNR). The typical cytoplasmic effectors of oomycetes are RXLR proteins. All RXLR effector genes discovered so far contain the amino-terminal group Arg-XLeu-Arg, where X is an amino acid. As a result of the study, it was suggested that there are 563 RXLR genes in the P. infestans genome, which is 60% more than in P. sojae and P. ramorum. Approximately half of the RXLR genes in the P. infestans genome are species-specific. RXLR effectors have a wide variety of sequences. Among them, one large and 150 small families were identified. Unlike the main proteome, the RXLR effector genes are usually located in gene-poor and repeat-rich regions of the genome. The mobile elements that determine the dynamism of these regions facilitate recombination in these genes.
Cytoplasmic CRN effectors were originally identified in P. infestans transcripts encoding plant tissue necrosis peptides. Since their discovery, little has been known about the family of these effectors. Analysis of the P. Infestans genome revealed a huge family of 196 CRN genes, which is significantly larger than in P. sojae (100 CRN) and P. ramorum (19 CRN). Like RXLRs, CRNs are modular proteins and consist of a highly conserved N-terminal LFLAK domain (50 amino acids) and an adjacent DWL domain containing different genes. Most CRNs (60%) possess a signal peptide.
The possibility of various CRNs to disrupt the cellular processes of the host plant has been studied. In the analysis of plant necrosis, the removal of CRN2 proteins made it possible to identify the C-terminal region consisting of 234 amino acids (positions 173-407, DXG domain) and causing cell death. Analysis of P. infestans CRN genes revealed four different C-terminal regions, which also cause cell death within the plant. These include the newly identified DC domains (P. Infestans has 18 genes and 49 pseudogenes), as well as D2 (14 and 43) and DBF (2 and 1) domains that are similar to protein kinases. Proteins of CRN domains expressed in a plant are conserved (in the absence of signal peptides) in a plant cell and stimulate cell death by an intracellular mechanism. Another 255 sequences containing CRN domains most likely do not function as genes.
The increase in the number and size of the RXLR and CRN effector gene families was presumably due to nonallelic homologous recombination and gene duplication. Despite the fact that the genome contains a large number of active mobile elements, there is still no direct evidence of the transfer of effector genes.
Methods used in the study of population structure
The study of the genetic structure of populations is currently based on the analysis of pure cultures of its constituent strains. Analysis of populations without isolating pure crops is also carried out for specific purposes, such as, for example, studying the aggressiveness of a population or the presence of strains resistant to fungicides in it (Filippov et al., 2004; Derevyagina et al., 1999). This type of research involves the use of special methods, the description of which is beyond the scope of this review. For the comparative analysis of strains, a number of methods are used based both on the analysis of the DNA structure and on the study of phenotypic manifestations. Comparative analysis of populations has to deal with a large number of isolates, which imposes certain requirements on the methods used. Ideally, they should meet the following requirements (Cooke, Lees, 2004, Mueller, Wolfenbarger, 1999):
- be cheap, easy to implement, do not require significant time expenditures, be based on generally available technologies (for example, PCR);
- must generate a sufficiently large number of independent codominant marker features;
- have high reproducibility;
- use the minimum amount of tissue to be examined;
- be specific to the substrate (the contamination present in the culture should not affect the results);
- do not require the use of hazardous procedures and highly toxic chemicals.
Unfortunately, there are no methods corresponding to all of the above parameters. For a comparative study of strains in our time, methods are used based on the analysis of phenotypic traits: virulence to potato and tomato varieties (potato and tomato races), mating type, spectra of peptidase isoenzymes and glucose-6-phosphate isomerase, and on analysis of DNA structure: length polymorphism restriction fragment (RFLP), which is usually supplemented with a hybridization probe RG 57, analysis of microsatellite repeats (SSR and InterSSR), amplification with random primers (RAPD), amplification of restriction fragments (AFLP), amplification with primers homologous to the sequences of mobile elements (for example, Inter SINE PCR), determination of mitochondrial DNA haplotypes.
Brief descriptions of methods for comparative study of strains used in work with P. Infestans
Phenotypic marker traits
"Potato" races
“Potato” races are a commonly researched and used marker. “Simple potato” races have one gene for potato virulence, “complex” ones - at least two. Black et al. (1953), summarizing all the data available to them, found that the phytophthora race is capable of infecting plants with the resistance gene / genes corresponding to the P. infestans virulence gene / genes, and found races 1, 2, 3, and 4 that infect plants with genes R1, R2, R3 and R4, respectively, i.e. the interaction between the parasite and the host occurs according to the gene for gene principle. Further, Black, with the participation of Gallegly and Malcolmson, discovered the resistance genes R5, R6, R7, R8, R9, R10 and R11, as well as the corresponding races (Black, 1954; Black & Gallegly, 1957; Malcolmson & Black, 1966; Malcolmson, 1970).
There is an extensive body of data on the racial composition of the pathogen from different regions. Without analyzing these data in detail, we will indicate only a general trend: where varieties with new resistance genes or their combinations were used, at first there was some weakening of late blight, but then races with the corresponding virulence genes appeared and were selected and outbreaks of late blight resumed. Specific virulence against the first 4 resistance genes (R1-R4) was rarely observed in the collections collected before the introduction into cultivation of varieties with these genes, but the number of virulent strains increased sharply when the pathogen was parasitized on varieties carrying these genes. Genes 5-11, on the other hand, were quite common in collections (Shaw, 1991).
A study of the ratio of various races during the growing season, conducted in the late 1980s, showed that at the beginning of the development of the disease, clones with low aggressiveness and 1-2 virulence genes predominate in the population.
Further, with the development of late blight, the concentration of the original clones decreases and the number of "complex" races with high aggressiveness increases. The occurrence of the latter by the end of the season reaches 100%. When storing tubers, there is a decrease in aggressiveness and a loss of individual virulence genes. The dynamics of clone replacement can occur in different varieties in different ways (Rybakova & Dyakov, 1990). However, our studies in 2000-2010 showed that complex races are found from the very beginning of epiphytotics among strains isolated from both potatoes and tomatoes. This is probably due to changes in the populations of P. Infestans in Russia.
By 1988-1995, the occurrence of “superraces” with all or almost all virulence genes in different regions reached 70-100%. This situation was noted, for example, in Belarus, in the Leningrad and Moscow regions, in North Ossetia and in Germany (Ivanyuk et al., 2002a, 2002b; Polityko, 1994; Schober-Butin et al., 1995).
"Tomato" races
In tomato cultivars, only 2 genes of resistance to late blight were found - Ph1 (Gallegly & Marvell, 1955) and Ph2 (Al-Kherb, 1988). As in the case of the potato races, the interaction between tomatoes and P. infestans occurs on a gene-by-gene basis. The T0 race infects varieties that do not have resistance genes (most of the industrially used varieties), the T1 race infects varieties with the Ph1 gene (Ottawa), and the T2 race infects varieties with the Ph2 gene.
In Russia, almost exclusively T0 was found on potatoes; T0 predominated on tomatoes at the beginning of the season, but later it was replaced by the T1 race (Dyakov et al., 1975, 1994). After 2000, T1 on potatoes in many populations began to occur at the very beginning of the epiphytotic period. In the United States, potato strains were non-pathogenic to tomato, as well as races T0, T1, and T2, while T1 and T2 predominated on tomatoes (Vartanian & Endo, 1985; Goodwin et al., 1995).
Mating type
To conduct the study, tester (reference) strains with known mating types - A1 and A2 are required. The test isolate is inoculated with them in pairs in Petri dishes with oat agar medium. After incubation for 10 days, the plates are examined for the presence or absence of oospores in the medium in the contact zone of the strains. There are 4 options: the strain belongs to the A1 mating type, if it forms oospores with the A2 tester, to A2, if it forms oospores with the A1 tester, to A1A2, if it forms oospores with both testers, or is sterile (00), if it does not form oospores with no tester (the last two groups are rare).
To more quickly determine the types of mating, attempts were made to identify regions of the genome associated with the type of mating, with the aim of further using them to determine the type of mating by PCR. One of the first successful experiments to identify such a site was conducted by American researchers (Judelson et al., 1995). Using the RAPD method, they were able to identify the W16 region associated with mating type in the offspring of the two crossed isolates, and to design a pair of 24-bp primers to amplify it (W16-1 (5'-AACACGCACAAGGCATATAAATGTA-3 ') and W16-2 (5' -GCGTAATGTAGCGTAACAGCTCTC-3 ') After restriction of the PCR product with restriction enzyme HaeIII, it was possible to separate isolates with pairing types A1 and A2.
Another attempt to obtain PCR markers to determine mating types was undertaken by Korean researchers (Kim, Lee, 2002). They identified specific products using the AFLP method. As a result, a pair of primers PHYB-1 (forward) (5'-GATCGGATTAGTCAGACGAG-3 ') and PHYB-2 (5'-GCGTCTGCAAGGCGCATTTT-3') were developed, allowing selective amplification of the genome region associated with the A2 mating type. Subsequently, they continued this work and designed primers 5 'AAGCTATACTGGGACAGGGT-3' (INF-1, forward) and 5'-GCGTTCTTTCGTATTACCAC-3 '(INF-2), allowing selective amplification of the Mat-A1 region, characteristic of strains with mating type A1. The use of PCR diagnostics of mating types showed good results when studying populations of P. infestans in the Czech Republic (Mazakova et al., 2006), Tunisia (Jmour, Hamada, 2006), and other regions. In our laboratory (Mytsa, Elansky, unpublished), 34 P. infestans strains isolated from the affected organs of potatoes and tomatoes in different regions of Russia (Kostroma, Ryazan, Astrakhan, and Moscow regions) were analyzed. The results of PCR analysis using specific primers more than 90% coincided with the results of the analysis of the mating type by the traditional method on a nutrient medium.
Table 1. Variability of resistance within the Sib 1 clone (Elansky et al., 2001)
Sample collection location | Number of isolates analyzed | Number of sensitive (S), weakly resistant (SR) and resistant (R) strains, pcs (%) | ||
S | SR | R | ||
G. Vladivostok | 10 | 1 (10) | 4 (40) | 5 (50) |
G. Chita | 5 | 0 | 0 | 5 (100) |
Irkutsk | 9 | 9 (100) | 0 | 0 |
G. Krasnoyarsk | 13 | 12 (92) | 1 (8) | 0 |
Yekaterinburg city | 15 | 8 (53) | 1 (7) | 6 (40) |
O. Sakhalin | 66 | 0 | 0 | 66 (100) |
Omsk region | 18 | 0 | 0 | 18 (100) |
Metalaxyl resistance as a population marker
In the early 1980s, powerful outbreaks of late blight caused by metalaxyl-resistant P. infestans strains were noted in various regions. Potato farms in many countries have suffered significant losses (Dowley & O'Sullivan, 1981; Davidse et al., 1983; Derevyagina, 1991). Since then, in many countries of the world, constant monitoring of the occurrence of phenylamide-resistant strains in P. infestans populations has been conducted. In addition to a practical assessment of the prospects for the use of phenylamide-containing drugs, building a system of protective measures and predicting epiphytoties, resistance to these drugs has become one of the marker features widely used for comparative analysis of populations of this pathogen. However, the use of resistance to metalaxyl in comparative population studies should be carried out taking into account the fact that: 1 - the genetic basis of resistance has not yet been precisely determined, 2 - resistance to metalaxyl is a selectively dependent trait that can change depending on the use of phenylamides, 3 - different the degree of sensitivity to metalaxyl strains within one clonal line (table. 1).
Spectra of isozymes
Isozyme markers are usually independent of external conditions, show Mendelian inheritance and are codominant, allowing to distinguish between homo- and heterozygotes. The use of proteins as gene markers makes it possible to identify both large reorganizations of the genetic material, including chromosomal and genomic mutations, and single amino acid substitutions.
Electrophoretic studies of proteins have shown that most enzymes exist in organisms in the form of several fractions differing in electrophoretic mobility. These fractions are the result of encoding multiple forms of enzymes by different loci (isozymes or isozymes) or by different alleles of the same locus (allozymes or alloenzymes). That is, isozymes are different forms of one enzyme. Different forms have the same catalytic activity, but differ slightly in single amino acid substitutions in the peptide and in charge. Such differences are revealed during electrophoresis.
When studying P. infestans strains, the spectra of isoenzymes of two proteins, peptidase and glucose-6-phosphate isomerase, are used (this enzyme is monomorphic in Russian populations, therefore, methods of its study are not presented in this work). To separate them into isozymes in an electric field, protein preparations isolated from the studied organisms are applied to a gel plate placed in an electric field. The diffusion rate of individual proteins in the gel depends on the charge and molecular weight; therefore, in an electric field, the mixture of proteins is separated into separate fractions, which can be visualized using special dyes.
The study of peptidase isoenzymes is carried out on cellulose-acetate, starch or polyacrylamide gels. The most convenient is the method based on the use of cellulose acetate gels manufactured by Helena Laboratories Inc. It does not require large amounts of test materials, it allows one to obtain contrasting bands on the gel after electrophoresis for both enzyme loci, its implementation does not require large time and material costs (Fig. 2).
A small piece of mycelium is transferred into a 1,5 ml microtube, 1-2 drops of distilled water are added to it. After that, the sample is homogenized (for example, with an electric drill with a plastic attachment suitable for a microtube) and sedimented for 25 seconds on a centrifuge at 13000 rpm. 8 μl from each microtube. the supernatant is transferred to the applicator plate.
The cellulose acetate gel is removed from the buffer container, blotted between two sheets of filter paper and placed with the working layer on top of the plastic base of the applicator. The solution from the plate is transferred by the applicator onto the gel 2-4 times. The gel is transferred to an electrophoresis chamber,
Table 2. The composition of the solution used for staining cellulose acetate gel in the analysis of peptidase isoenzymes, a drop of paint (bromophenol blue) is placed on the edge of the gel.
TRIS HCl, 0,05M, Ph 8,0 2 ml
Peroxidase, 1000 U / ml 5 drops
o-dianisidine, 4 mg / ml 8 drops
MgCl2, 20 mg / ml 2 drops
Gly-Leu, 15 mg / ml 10 drops
L-amino-acid oxidase, 20 u / ml 2 drops
Electrophoresis is carried out for 20 minutes. at 200 V. After electrophoresis, the gel is transferred to a painting table and painted with a special painting solution (Table 2). 10 ml of 1,6% DIFCO agar is preliminarily melted in a microwave oven, cooled to 60 ° C, after which 2 ml of agar is mixed with a paint mixture and poured onto the gel. Stripes appear within 15-20 minutes. The L-amino-acid oxidase reagent is added immediately before mixing the solution with molten agar.
In Russian populations, the Pep 1 locus is represented by genotypes 100/100 and 92/100. Homozygote 92/92 is extremely rare (about 0,1%). Locus Rehr 2 is represented by three genotypes 100/100, 100/112, and 112/112, and all 3 variants are quite common (Elanky and Smirnov, 2003, Fig. 2).
Genome research
Restriction fragment length polymorphism with subsequent hybridization (RFLP-RG 57)
The total DNA is treated with Eco R1 restriction enzyme, the DNA fragments are separated by agarose gel electrophoresis. Nuclear DNA is very large and has many repetitive sequences; therefore, it is difficult to directly analyze the numerous fragments obtained by the action of restriction enzymes. Therefore, the DNA fragments separated in the gel are transferred to a special membrane and used for hybridization with the RG 57 probe, which includes nucleotides labeled with radioactive or fluorescent labels. This probe hybridizes with repetitive genomic sequences (Goodwin et al., 1992, Forbes et al., 1998). After visualization of the results of hybridization on a light- or radioactive material, a multi-locus hybridization profile (fingerprinting) is obtained, represented by 25-29 fragments (Forbes et al., 1998). Asexual (clonal) offspring will have the same profiles. By the arrangement of the bands on the electrophoretogram, the similarities and differences of the compared organisms are judged.
Mitochondrial DNA haplotypes
In most eukaryotic cells, mtDNA is presented in the form of a double-stranded circular DNA molecule, which, unlike the nuclear chromosomes of eukaryotic cells, replicates semi-conservatively and is not associated with protein molecules.
The mitochondrial genome of P. infestans was sequenced, and a number of works were devoted to the analysis of restriction fragment lengths (Carter et al, 1990, Goodwin, 1991, Gavino, Fry, 2002). After Griffith and Shaw (1998) developed a simple and fast method for determining mtDNA haplotypes, this marker became one of the most popular in P. Infestans studies. F2-R2 (Table 4) and their subsequent restriction with restriction enzymes MspI (4st fragment) and EcoR3 (1nd fragment). The method allows you to identify 1 haplotypes: Ia, IIa, Ib, IIb. Type II differs from type I by the presence of an 2 bp insert and a different location of restriction sites in the P4 and P1881 regions (Fig. 2).
Since 1996, among the strains collected on the territory of Russia, only haplotypes Ia and IIa were noted (Elansky et al., 2001, 2015). They can be identified after separation of the restriction products with primer F2-R2 in an electric field (Fig. 4, 5). Types of mtDNA are used in comparative analysis of strains and populations. In a number of works, types of mitochondrial DNA were used to isolate clonal lines and passportize P. infestans isolates (Botez et al., 2007; Shein et al., 2009). Using the PCR-RFLP method, it was concluded that mtDNA is heterogeneous in the same P. infestans strain (Elansky and Milyutina, 2007). Amplification conditions: 1x (500 sec. 94 ° C), 40x (30 sec. 90 ° C, 30 sec. 52 ° C, 90 sec. 72 ° C); 1x (5 min. 72 ° C). Reaction mixture: (20 μl): 0,2 U Taq DNA polymerase, 1x 2,5 mM MgCl2-Taq buffer, 0,2 mM each dNTP, 30 pM primer and 5 ng of the analyzed DNA, deionized water - up to 20 μl.
Restriction of the PCR product is carried out for 4-6 hours at a temperature of 37 ° C. Restriction mixture (20 μl): 10x MspI (2 μl), 10x restriction buffer (2 μl), deionized water (6 μl), PCR product (10 μl).
Table 3. Primers used for amplification of mtDNA polymorphic regions
Locus | Primer | Primer length and placement | PCR product length | Restrictase |
---|---|---|---|---|
P2 | F2: 5'- TTCCCTTTGTCCTCTACCGAT | 21; 13619-13639 | 1070 | MspI |
R2: 5'- TTACGGCGGTTTAGCACATACA | 22; 14688-14667 | |||
P4 | F4: 5'- TGGTCATCCAGAGGTTTATGTT | 22; 9329-9350 | 964 | EcoRI |
R4:5 - CCGATACCGATACCAGCACCAA | 22; 10292-10271 |
Random primer amplification (RAPD)
When carrying out RAPD, one primer is used (sometimes several primers simultaneously) with an arbitrary nucleotide sequence, usually 10 nucleotides in length, with a high content (from 50%) of GC nucleotides and a low annealing temperature (about 35 ° C). Such primers "land" on numerous complementary sites in the genome. After amplification, a large number of amplicons are obtained. Their number depends on the primer (s) used and the reaction conditions (MgCl2 concentration and annealing temperature).
Visualization of amplicons is carried out by distillation in polyacrylamide or agarose gel. When performing RAPD analysis, it is necessary to carefully monitor the purity of the analyzed material, since contamination with other living objects can cause a significant increase in the number of artifacts, which are quite numerous even in the analysis of pure material (Perez et al, 1998). The use of this method in the study of the P. infestans genome is reflected in many works (Judelson, Roberts, 1999, Ghimire et al., 2002, Carlisle et al., 2001). The selection of reaction conditions and primers (51 10-nucleotide primers were studied) are given in the article by Abu-El Samen et al., (2003).
Microsatellite Repeat Analysis (SSR)
Microsatellite repeats (simple sequence repeats, SSR) are tandemly repeating short sequences of 1-3 (sometimes up to 6) nucleotides present in the nuclear genomes of all eukaryotes. The number of successive repeats can vary from 10 to 100. Microsatellite loci occur with a fairly high frequency and are more or less evenly distributed throughout the genome (Lagercrantz et al., 1993). Polymorphism of microsatellite sequences is associated with differences in the number of repeats of the basic motif. Microsatellite markers are codominant, which makes it possible to use them to analyze the structure of a population, determine kinship, migration paths of genotypes, etc. Among other advantages of these markers, one should note their high polymorphism, good reproducibility, neutrality, and the ability to perform automatic analysis and evaluation.Analysis of polymorphism of microsatellite repeats is carried out by PCR amplification using primers complementary to unique sequences flanking microsatellite loci. Initially, the analysis was carried out with the separation of the reaction products on a polyacrylamide gel. Later, the employees of the Applied Biosystems company proposed to use fluorescently labeled primers with detection of reaction products using an automatic laser detector (Diehl et al., 1990), and then standard automatic DNA sequencers (Ziegle et al., 1992). Labeling of primers with various fluorescent dyes allows you to analyze several markers at once on one lane and, accordingly, significantly increase the productivity of the method and increase the accuracy of the analysis.
The first publications devoted to the use of SSR analysis for the study of P. infestans appeared in the early 2000s. (Knapova, Gisi, 2002). Not all markers proposed by the authors showed a sufficient degree of polymorphism, however, two of them (4B and G11) were included in the set of 12 SSR markers proposed by Lees et al. (2006) and subsequently adopted in the Eucablight research network (www.eucablight .org) as a standard for P. infestans. A few years later, a study was published on the creation of a system for multiplex analysis of P. infestans DNA based on eight SSR markers (Li et al., 2010). Finally, after evaluating all previously proposed markers and selecting the most informative of them, as well as optimizing primers, fluorescent labels, and amplification conditions, the same group of authors presented a system of one-step multiplex analysis, including 12 markers (Table 4; Li et al. , 2013a). The primers used in this system were selected and labeled with one of four fluorescent markers (FAM, VIC, NED, PET) so that the ranges of the allele sizes of primers with the same labels did not overlap.
The authors performed the analysis on a PTC200 amplifier (MJ Research, USA) using QIAGEN multiplex PCR kits or QIAGEN Typeit Microsatellite PCR kits. The volume of the reaction mixture was 12.5 μL. The amplification conditions were as follows: for QIAGEN multiplex PCR: 95 ° C (15 min), 30x (95 ° C (20 sec), 58 ° C (90 sec), 72 ° C (60 sec), 72 ° C (20 min); for QIAGEN Type-it Microsatellite PCR: 95 ° C (5 min), 28x (95 ° C (30 sec), 58 ° C (90 sec), 72 ° C (20 sec), 60 ° C (30 min).
Separation and visualization of PCR products was carried out using an ABI3730 automatic capillary DNA analyzer (Applied Biosystems).
Table 4. Characteristics of 12 standard SSR markers used for genotyping P. Infestans (Li et al., 2013a)
Name | Number of alleles | Size range alleles (bp) | Primers |
PiG11 | 13 | 130-180 | F: NED-TGCTATTTATCAAGCGTGGG R: GTTTTCAATCTGCAGCCGTAAGA |
Ft02 | 4 | 255-275 | F: NED-ACTTGCAGAACTACCGCCC R: GTTTGACCACTTTCCTCGGTTC |
PinfSSR11 | 4 | 325-360 | F: NED-TTAAGCCACGACATGAGCTG R: GTTTAGACAATTGTTTTGTGGTCGC |
D13 | 16 | 100-185 | FAM-TGCCCCCTGCTCACTC R: GCTCGAATTCATTTTCAGACTTG |
PinfSSR8 | 4 | 250-275 | FAM-AATCTGATCGCAACTGAGGG R: GTTTACAAGATACACACGTCGCTCC |
PinfSSR4 | 7 | 280-305 | FAM-TCTTGTTCGAGTATGGCGACG R: GTTTCACTTCGGGAGAAAGGCTTC |
Ft04 | 4 | 160-175 | F: VIC-AGCGGCTTTACCGATGG R: GTTTCAGCGGCTGTTTCGAC |
Ft70 | 3 | 185-205 | F: VIC-ATGAAAATACGTCAATGCTCG R: CGTTGGATATTTCTATTTCTTCG |
PinfSSR6 | 3 | 230-250 | F: GTTTTGGTGGGGCTGAAGTTTT R: VIC-TCGCCACAAGATTTATTCCG |
Ft63 | 3 | 265-280 | F: VIC-ATGACGAAGATGAAAGTGAGG R: CGTATTTTCCTGTTTATCTAACACC |
PinfSSR2 | 3 | 165-180 | F: PET-CGACTTCTACATCAACCGGC R: GTTGCTTGGACTGCGTCTTTAGC |
Pi4B | 5 | 200-295 | F: PET-AAAATAAAGCCTTTGGTTCA R: GCAAGCGAGGTTTGTAGATT |
An example of visualizing the analysis results is shown in Fig. 6. The results were analyzed using GeneMapper 3.7 software by comparing the obtained data with the data of known isolates. To facilitate the interpretation of the analysis results, it is necessary to include 1-2 reference isolates with a known genotype in each study.
The proposed research method was tested on a significant number of field samples, after which the authors carried out standardization of protocols between laboratories of two organizations, The James Hutton Institute (UK) and Wageningen University & Research (Netherlands), which, along with the possibility of using standard FTA cards for simplified collection and shipment of P. infestans DNA samples, made it possible to talk about the possibility of commercial use of this development. In addition, a fast and accurate method of genotyping P. infestans isolates using multiplex SSR analysis made it possible to conduct standardized studies of populations of this pathogen on a global scale, and the creation of a world database on late blight within the framework of the Eucablight project (www.eucablight.org), including , including the results of microsatellite analysis, made it possible to track the emergence and spread of new genotypes around the world.
Amplified restriction fragment length polymorphism (AFLP). AFLP (amplified fragment length polymorphism) is a technology for generating random molecular markers using specific primers. In AFLP, DNA is treated with a combination of two restriction enzymes. Specific adapters are ligated to the sticky ends of the restriction fragments.
These fragments are then amplified using primers complementary to the adapter sequence and restriction site and additionally carrying one or more random bases at their 3 'ends. The set of fragments obtained depends on restriction enzymes and randomly selected nucleotides at the 3'-ends of the primers (Vos et al., 1995). AFLP - genotyping is used to quickly study the genetic variation of various organisms.
A detailed description of the method is given in the works of Mueller, Wolfenbarger, 1999, Savelkoul et al., 1999. Much work comparing the resolution of AFLP and SSR methods has been carried out by Chinese researchers. The phenotypic and genotypic characteristics of 48 P. infestans isolates collected from five regions of North China were studied. The AFLP spectra revealed eight different DNA genotypes, in contrast to the SSR genotypes, for which no diversity was found (Guo et al., 2008).
Amplification with primers homologous to the sequences of mobile elements
Markers derived from sequences of retrotransposons are very convenient for genetic mapping, the study of genetic diversity and evolutionary processes (Schulman, 2006). If primers are made to complement the stable sequences of certain mobile elements, it is possible to amplify the genome regions located between them. In studies of the causative agent of late blight, the method of amplifying parts of the genome using a primer complementary to the core sequence of the SINE (Short Interspersed Nuclear Elements) retropazone was successfully applied (Lavrova and Elansky, 2003). Using this method, differences were revealed even in asexual offspring of one isolate. In this regard, it was concluded that the inter - SINE - PCR method is highly specific and the rate of movement of SINE elements in the Phytophthora genome is high.
In the genome of P. infestans, 12 families of short retrotransposons (SINEs) have been identified; the species distribution of short retrotransposons was investigated; elements (SINEs) that are found in the genome of only P. infestans were identified (Lavrova, 2004).
Features of the application of methods of comparative study of strains in population studies
When planning a study, one must clearly understand the goals that it pursues and use the appropriate methods. Thus, some methods make it possible to generate a large number of independent marker signs, but at the same time have low reproducibility and strongly depend on the reagents used, reaction conditions, and the contamination of the test material. Therefore, in each study of a group of strains, it is necessary to use several standard (reference) isolates, but even in this case, the results of several experiments are very difficult to combine.
This group of methods includes RAPD, AFLP, InterSSR, InterSINE PCR. After amplification, a large number of DNA fragments of different sizes are obtained. It is advisable to use such techniques if it is necessary to establish differences between closely related strains (parent-offspring, wild type-mutants, etc.), or in cases where a detailed analysis of a small sample is required. Thus, the AFLP method is widely used in genetic mapping of P. infestans (van der Lee et al., 1997) and in intrapopulation studies (Knapova, Gisi, 2002, Cooke et al, 2003, Flier et al, 2003). Such methods are inappropriate to use when creating databases of strains, because it is practically impossible to unify the accounting of results when conducting analyzes in different laboratories.
Despite the seeming simplicity and speed of execution (DNA isolation without good purification, amplification, visualization of results), this group of methods requires the use of a special method for documenting the results: distillation in polyacrylamide gel with labeled (radioactive or luminescent) primers and subsequent exposure to light or radioactive material. Conventional ethidium bromide agarose gel imaging is generally not suitable for these methods because a large number of DNA fragments of different sizes can fuse.
Other methods, on the contrary, make it possible to generate a small number of features with their very high reproducibility. This group includes the study of mitochondrial DNA haplotypes (only two haplotypes Ia and IIa are noted in Russia), mating type (most isolates are subdivided into 2 types: A1 and A2, self-fertile SF are rarely found) and peptidase isozyme spectra (two loci Pep1 and Pep2 , consisting of two isozymes each) and glucose-6-phosphate isomerase (in Russia there is no variability in this trait, although significant polymorphism is noted in other countries of the world). It is advisable to use these features when analyzing collections, compiling regional and global databases. In the case of the analysis of isozymes and haplotypes of mitochondrial DNA, it is possible to do without standard strains at all, while in the analysis of mating types, two test isolates with known mating types are required.
The reaction conditions and reagents can only affect the contrast of the product on the electrophoretogram; the manifestation of artifacts in these types of studies is unlikely.
Currently, the majority of populations in the European part of Russia are represented by strains of both types of mating (Table 6), among them there are isolates with types Ia and IIa of mitochondrial DNA (other types of mtDNA found in the world have not been found in Russia after 1993). The spectra of peptidase isozymes are represented by two genotypes at the Pep1 locus (100/100, 92/92 and heterozygote 92/100, and the 92/92 genotype is extremely rare (<0,3%)) and two genotypes at the Pep 2 locus (100/100 , 112/112 and heterozygote 100/112, with the genotype 112/112 occurring less frequently than 100/100, but also quite often).
There was no variability in the spectrum of isoenzymes of glucose-6-phosphate isomerase after 1993 (the disappearance of the clonal line US-1); all studied isolates had the 100/100 genotype (Elansky and Smirnov, 2002).
The third group of methods allows obtaining a sufficient group of independent marker features with high reproducibility. Today, this group includes the RFLP-RG57 probe, which produces 25-29 DNA fragments of different sizes. RFLP-RG57 can be used both when analyzing samples and compiling databases. However, this method is much more expensive than the previous ones, it is time-consuming, and requires a sufficiently large amount of highly purified DNA. Therefore, the researcher is forced to limit the amount of test material.
The development of RFLP-RG57 in the early 90s of the last century significantly intensified population studies of the causative agent of late blight. It became the basis of the method based on the selection and analysis of "Clonal lines" (see below). Along with RFLP-RG57, mating type, DNA fingerprinting (RFLP-RG57 method), spectra of peptidase and glucose-6-phosphate isomerase isoenzymes, and mitochondrial DNA type are used to identify clonal lines. Thanks to him, it was shown al., 1994), the replacement of old populations by new ones (Drenth et al, 1993, Sujkowski et al, 1994, Goodwin et al, 1995a), and clonal lineages that prevail in many countries of the world were identified. Studies of Russian strains using this method showed a high genotypic polymorphism of the strains of the European part and monomorphism of the populations of the Asian and Far Eastern parts of Russia (Elansky et al, 2001). And now this method remains the main one in population studies of P. infestans. However, its wide distribution is hindered by its rather high cost and labor intensity in execution.
Another promising technique that is rarely used in P. infestans studies is microsatellite repeat (SSR) analysis. Currently, this method is widely used to isolate clonal lines. For the analysis of strains, such phenotypic marker traits as the presence of virulence genes to potato varieties (Avdey, 1995, Ivanyuk et al., 2002, Ulanova et al., 2003) and tomato were widely used (and continue to be used). By now, genes of virulence to potato varieties have lost their value as marker traits for population studies due to the appearance of the maximum (or close to it) number of virulence genes in the vast majority of isolates. At the same time, the T1 virulence gene for tomato cultivars carrying the corresponding Ph1 gene is still successfully used as a marker trait (Lavrova et al., 2003; Ulanova et al., 2003).
In many works, resistance to fungicides is used as a marker trait. This trait is undesirable to use in population studies due to the rather easy appearance of resistance mutations in clonal lines after the application of metalaxyl- (or mefenoxam-) containing fungicides in the field. For example, significant differences in the level of resistance were shown within the Sib1 clonal line (Elansky et al., 2001).
Thus, mating type, peptidase isoenzyme spectrum, mitochondrial DNA type, RFLP-RG57, SSR are the preferred marker features for creating data banks and labeling strains in collections. To compare limited samples, if it is necessary to apply the maximum number of marker features, you can use AFLP, RAPD, InterSSR, Inter-SINE PCR (Table 5). However, it should be remembered that these methods are poorly reproducible, and in each individual experiment (amplification electrophoresis cycle) it is necessary to use several reference isolates.
Table 5. Comparison of different methods of research of strains P. infestans
Criterion | TC | Isofer cops | MtDNA | RFLP-RG57 | RAPD | ISSR | SSR | AFLP | Rev |
---|---|---|---|---|---|---|---|---|---|
Amount of information | Н | Н | Н | С | В | В | С | В | В |
Reproducibility | В | В | В | В | Н | Н | С | С | С |
Possibility of artifacts | Н | Н | Н | Н | В | С | Н | С | В |
Price | Н | С | Н | В | Н | Н | Н | С | Н |
Labor intensity | Н | Н | Н | В | NS * | NS * | Н | С | NS * |
Analysis speed ** | В | Н | Н | С | Н | Н | Н | Н | Н |
Note: H - low, C - medium, B - high; НС * - labor intensity is low when using agarose gel or automatic
genotyper, medium - by distillation in polyacrylamide gel with labeled primers,
** - not counting the time spent on growing mycelium for DNA isolation.
Population structure
Clonal lines
In the absence of recombination or its insignificant contribution to the population structure, the population consists of a certain number of clones, genetic exchanges between which are extremely rare.
In such populations, it is more informative to study not the frequencies of individual genes, but the frequencies of genotypes that have a common origin (clonal lines or clonal lineages) and differ only in point mutations. Population studies of the late blight pathogen and analysis of clonal lines have accelerated significantly since the advent of the RFLP-RG57 method in the early 90s of the last century. Along with RFLP-RG57, mating type, spectra of peptidase and glucose-6-phosphate isomerase isoenzymes, and mitochondrial DNA type are used to identify clonal lines. The characteristics of the most common clonal lines are shown in Table 6.
Clone US-1 dominated populations everywhere until the end of the 80s, after which it began to be replaced by other clones and disappeared from Europe and North America. It is now found in the Far East (Philippines, Taiwan, China, Japan, Korea, Koh et al., 1994, Mosa et al, 1993), in Africa (Uganda, Kenya, Rwanda, Goodwin et al, 1994, Vega-Sanchez et al., 2000; Ochwo et al., 2002) and in South America (Ecuador, Brazil, Peru, Forbes et al., 1997, Goodwin et al., 1994). No strains belonging to the US-1 line have been identified in Australia alone. Apparently, P. infestans isolates came to Australia with another wave of migration (Goodwin, 1997).
Clone US-6 migrated from northern Mexico to California in the late 70s and caused an epidemic there in potatoes and tomatoes after 32 years without disease. Due to its high aggressiveness, it supplanted the US-1 clone and began to dominate on the west coast of the United States (Goodwin et al., 1995a).
The genotypes US-7 and US-8 were discovered in the United States in 1992, and already in 1994 were widely distributed in the United States and Canada. During one field season, clone US-8 is able to almost completely displace clone US-1 in potato plots initially infected with both clones at an equal concentration (Miller and Johnson, 2000).
Clones BC-1 to BC-4 have been identified in British Columbia in a small number of isolates from Goodwin et al., 1995b). Clone US-11 spread widely in the United States and supplanted US-1 in Taiwan. Clones JP-1 and EC-1, along with clone US-1, are common in Japan and Ecuador, respectively (Koh et al., 1994; Forbes et al., 1997).
SIB-1 is a clone that prevailed in Russia over a vast territory from the Moscow region to Sakhalin. In the Moscow region, it was discovered in 1993, and some field populations consisted mainly of strains of this clonal line, highly resistant to metalaxyl. After 1993, the prevalence of this clone decreased significantly. Outside the Urals in 1997-1998, SIB-1 was found everywhere, with the exception of the Khabarovsk Territory (the clone SIB-2 is widespread there). The spatial separation of clones with different types of mating excludes the sexual process in Siberia and the Far East. In the Moscow region, in contrast to Siberia, the population is represented by many clones; almost every isolate has a unique multilocus genotype (Elansky et al., 2001, 2015). This diversity cannot be explained solely by the importation of strains of the fungus from different parts of the world with imported seed material. Since both types of mating occur in the population, it is possible that its diversity is also due to recombination. Thus, in British Columbia, the emergence of genotypes BC-2, BC-3, and BC-4 is assumed due to hybridization of clones BC-1 and US-6 (Goodwin et al., 1995b). It is possible that hybrid strains are found in Moscow populations. For example, strains MO-4, MO-8 and MO-11 heterozygous for the PEP locus can be hybrids between strains MO-12, MO-21, MO-22, having the A2 mating type and homozygous for one allele of the PEP locus and the strain MO-8, having the A1 mating type and homozygous for the other allele of the locus. And if this is so, and in modern populations of P. infestans there is a tendency to an increase in the role of the sexual process, then the information value of the analysis of multilocus clones will decrease (Elansky et al., 2001, 2015).
Variation in clonal lines
Until the 90s of the 20th century, the clonal line US-1 was widespread in the world. Most of the field and regional populations consisted exclusively of strains with the US-1 genotype. However, differences between isolates were also observed, most likely caused by a mutational process. Mutations occurred in both nuclear and mitochondrial DNA and affected, among other things, the level of resistance to phenylamide drugs and the number of virulence genes. Lines that differ from the original genotypes by mutations are indicated by additional numbers after the dot following the name of the original genotype (for example, the US-1.1 mutant line of the clonal line US-1). Fingerprinting DNA lines US-1.5 and US-1.6 contain accessory lines of different sizes (Goodwin et al., 1995a, 1995b); the clonal line US-6.3 also differs from US-6 in one accessory line (Goodwin, 1997, Table 7).
In the study of mitochondrial DNA, it was found that in the clonal line US-1 only type 1b of mitochondrial DNA is found (Carter et al., 1990). However, in the study of strains of this clonal lineage from Peru and the Philippines, isolates were found whose mitochondrial DNA types differed from 1b by the presence of insertions and deletions (Goodwin, 1991, Koh et al., 1994).
Table 6. Multilocus genotypes of some P. infestans clonal lines
Name | Mating type | Isozymes | DNA fingerprints | MtDNA type | |
GPI | PEP | ||||
US-1 | A1 | 86/100 | 92/100 | 1.0111010110011E + 24 | Ib |
US-2 | A1 | 86/100 | 92/100 | 1.0111010010011E + 24 | — |
US-3 | A1 | 86/100 | 92/100 | 1.0111000000011E + 24 | — |
US-4 | A1 | 100/100 | 92/92 | 1.0111010010011E + 24 | — |
US-5 | A1 | 100/100 | 92/100 | 1.0111010010011E + 24 | — |
US-6 | A1 | 100/100 | 92/100 | 1.0111110010011E + 24 | IIb |
US-7 | A2 | 100/111 | 100/100 | 1.0011000010011E + 24 | Ia |
US-8 | A2 | 100/111/122 | 100/100 | 1.0011000010011E + 24 | Ia |
US-9 | A1 | 100/100 | 83/100 | * | — |
US-10 | A2 | 111/122 | 100/100 | — | — |
US-11 | A1 | 100/111 | 92/100 | 1.0101110010011E + 24 | IIb |
US-12 | A1 | 100/111 | 92/100 | 1.0001000010011E + 24 | — |
US-14 | A2 | 100/122 | 100/100 | 1.0000000000011E + 24 | — |
US-15 | A2 | 100/100 | 92/100 | 1.0001000010011E + 24 | Ia |
US-16 | A1 | 100/111 | 100/100 | 1.0001100010011E + 24 | — |
US-17 | A1 | 100/122 | 100/100 | 1.0100010000011E + 24 | — |
US-18 | A2 | 100/100 | 92/100 | 1.0001000010011E + 24 | Ia |
US-19 | A2 | 100/100 | 92/100 | 1.0101010000011E + 24 | Ia |
EC-1 | A1 | 90/100 | 96/100 | 1.1111010010011E + 24 | IIa |
SIB-1 | A1 | 100/100 | 100/100 | 1.0001000110011E + 24 | IIa |
SIB-2 | A2 | 100/100 | 100/100 | 1.0001000010011E + 24 | IIa |
SIB-3 | A1 | 100/100 | 100/100 | 1.1001010100011E + 24 | IIa |
MO-1 | A2 | 100/100 | 100/100 | 1.0001000110011E + 24 | IIa |
MO-2 | A2 | 100/100 | 100/100 | 1.0001000010011E + 24 | Ia |
MO-3 | A1 | 100/100 | 100/100 | 1.0101000010011E + 24 | IIa |
MO-4 | A1 | 100/100 | 92/100 | 1.0101110110011E + 24 | IIa |
MO-5 | A1 | 100/100 | 100/100 | 1.0001010010011E + 24 | IIa |
MO-6 | A1 | 100/100 | 100/100 | 1.0101010010011E + 24 | Ia |
MO-7 | A1 | 100/100 | 92/100 | 1.0001000110011E + 24 | IIa |
MO-8 | A1 | 100/100 | 92/92 | 1.0101100010011E + 24 | IIa |
MO-9 | A1 | 100/100 | 92/100 | 1.0001000010011E + 24 | IIa |
MO-10 | A1 | 100/100 | 100/100 | 1.0101100000011E + 24 | Ia |
MO-11 | A1 | 100/100 | 92/100 | 1.0101010010011E + 24 | Ia |
MO-12 | A2 | 100/100 | 100/100 | 1.0101010010011E + 24 | Ia |
MO-13 | A1 | 100/100 | 100/100 | 1.0101010000011E + 24 | Ia |
MO-14 | A1 | 100/100 | 100/100 | 1.01010010011E + 22 | Ia |
MO-15 | A1 | 100/100 | 100/100 | 1.101110010011E + 23 | Ia |
MO-16 | A1 | 100/100 | 100/100 | 1.0001000000011E + 24 | IIa |
MO-17 | A1 | 86/100 | 100/100 | 1.0101010110011E + 24 | Ib |
MO-18 | A1 | 100/100 | 100/100 | 1.0101110010011E + 24 | IIa |
MO-19 | A1 | 100/100 | 100/100 | 1.0101010000011E + 24 | IIa |
MO-20 | A2 | 100/100 | 100/100 | 1.0101010000011E + 24 | IIa |
MO-21 | A2 | 100/100 | 100/100 | 1.0101010000011E + 24 | IIa |
Note: * - no data.
Table 7. Multilocus genotypes and their mutant lines
Name | Mating type | | DNA Fingerprints (RG57) | Notes | |
GPI | PEP-1 | ||||
US-1 | A1 | 86/100 | 92/100 | 1011101011001101000110011 | Original genotype 1 |
US-1.1 | A1 | 86/100 | 100/100 | 1011101011001101000110011 | Mutation in PEP |
US-1.2 | A1 | 86/100 | 92/100 | 1011101010001101000110011 | Mutation in RG57 |
US-1.3 | A1 | 86/100 | 92/100 | 1011101001001101000110011 | Mutation in RG57 |
US-1.4 | A1 | 86/100 | 100/100 | 1011101010001101000110011 | Mutation in RG57 and PEP |
US-1.5 | A1 | 86/100 | 92/100 | 1011101011001101010110011 | Mutation in RG57 |
US-6 | A1 | 100/100 | 92/100 | 1011111001001100010110011 | Original genotype 2 |
US-6.1 | A1 | 100/100 | 92 /92 | 1011111001001100010110011 | Mutation in PEP |
US-6.2 | A1 | 100/100 | 92/100 | 1011101001001100010110011 | Mutation in RG57 |
US-6.3 | A1 | 100/100 | 92/100 | 1011111001011100010110011 | Mutation in RG57 |
US-6.4 | A1 | 100/100 | 100/100 | 1011011001001100010110011 | Mutation in RG57 and PEP |
US-6.5 | A1 | 100/100 | 92/100 | 1011111001001100010010011 | Mutation in RG57 |
BR 1 | A2 | 100/100 | 100/100 | 1011101000001100001111011 | Original genotype 3 |
BR 1.1 | A2 | 100/100 | 100/100 | 1010101000001100001110011 | Mutation in RG57 |
There are also changes in the spectra of isozymes. As a rule, they are caused by the breakdown of an organism initially heterozygous for this enzyme into homozygous ones. In 1993, on tomato fruits, we identified a strain with characteristics typical for US-1: RG57 fingerprinting, mitochondrial DNA type, and 86/100 genotype for glucose-6-phosphatizomerase, but it was homozygous (100/100) for the first peptidase locus instead of a 92/100 heterozygote typical of this clonal line. We named the genotype of this strain MO-17 (Table 6). The mutant lines US-1.1 and US-1.4 also differ from US-1 by mutations at the first peptidase locus (Table 7).
Mutations leading to changes in the number of virulence genes for potato and tomato varieties are quite common. They were noted among the isolates of the clonal line US-1 in populations from the Netherlands (Drenth et al., 1994), Peru (Goodwin et al., 1995a), Poland (Sujkowski et al., 1991), northern North America (Goodwin et al., ., 1995b). Differences in the number of potato virulence genes were also noted among isolates of the clonal lines US-7 and US-8 in Canada and the United States (Goodwin et al., 1995a), among isolates of the SIB-1 line in the Asian part of Russia (Elansky et al, 2001 ).
Isolates with strong differences in the levels of resistance to phenylamide drugs were identified in monoclonal field populations, all of which belonged to the clonal line Sib-1 (Elansky et al, 2001, Table 1). Almost all strains of the clonal line US-1 are highly sensitive to metalaxyl; however, highly resistant isolates of this line were isolated in the Philippines (Koh et al., 1994) and in Ireland (Goodwin et al., 1996).
Modern populations of P. infestans
Central America (Mexico)
The P. infestans population in Mexico differs markedly from other world populations, which is primarily due to its historical position. Numerous studies of this population and related P. infestans species of the clade Phytophthora, as well as local species of the genus Solanum, led to the conclusion that the evolution of the pathogen in the central part of Mexico took place together with the evolution of host plants and was associated with sexual recombination (Grünwald, Flier , 2005). Both types of mating are represented in the population, and in equal proportions, and the presence of oospores in the soil, on plants and tubers of potatoes and wild-growing related species Solanum confirms the presence of a sexual process in the population (Fernández-Pavía et al., 2002). Recent studies of the Toluca Valley and its environs (the presumptive center of origin of the pathogen) confirmed the high genetic diversity of the local population of P. infestans (134 multilocus genotypes in a sample of 176 samples) and the presence of several differentiated subpopulations in the region (Wang et al., 2017). The factors contributing to this differentiation are the spatial division of subpopulations characteristic of the highlands of central Mexico, differences in cultivation conditions and potato varieties used in valleys and mountains, and the presence of wild tuberous Solanum species that can act as alternative hosts (Fry et al ., 2009).
However, it should be noted that the populations of P. infestans in northern Mexico are more clonal in nature and are more similar to North American populations, which may indicate that these are the new genotypes (Fry et al., 2009).
North America
The North American populations of P. infestans have always had a very simple structure and their clonal character was established long before the use of microsatellite analysis. Until 1987, the clonal line US-1 dominated in the United States and Canada (Goodwin et al., 1995). In the mid-70s, when metalaxyl-based fungicides appeared, this clone began to be replaced by other, more resistant genotypes that migrated from Mexico (Goodwin et al., 1998). By the end of the 90s. the US-8 genotype completely replaced the US-1 genotype in the United States and became the dominant clonal line on potatoes (Fry et al., 2009; Fry et al., 2015). The situation was different with tomatoes, which constantly contained several clonal lines, and their composition changed from year to year (Fry et al., 2009).
In 2009, a large-scale epidemic of late blight broke out in the United States on tomatoes. A feature of this pandemic was its almost simultaneous onset in many places in the northeastern United States, and it turned out to be associated with massive sales of infected tomato seedlings in large garden centers (Fry et al., 2013). The crop losses were enormous. Microsatellite analysis of the affected samples revealed that the pandemic strain belonged to the clonal line US-22 A2 mating type. In 2009, the share of this genotype in the American population of P. infestans reached 80% (Fry et al., 2013). In subsequent years, the proportion of aggressive genotypes US-23 (mainly on tomatoes) and US-24 (on potatoes) steadily increased in the population, however, after 2011, the detection rate of US-24 decreased significantly, and to date, about 90% of the pathogen population in The United States is represented by the US-23 genotype (Fry et al., 2015).
In Canada, as in the United States, at the end of the 90s. the dominant genotype US-1 was supplanted by US-8, the dominant position of which remained unchanged until 2008. In Canada, there were serious late blight epidemics associated with the sale of infected tomato seedlings, but they were caused by the genotypes US-2009 and US-2010 (Kalischuk et al., 23). The clear geographical differentiation of these genotypes was remarkable: US-8 dominated the western provinces of Canada (2012%), while US-23 dominated the eastern provinces (68%). In subsequent years, US-8 spread to the eastern regions; however, in general, its share in the population slightly decreased against the background of the appearance of genotypes US-83 and US-23 in the country (Peters et al., 22). To date, US-24 maintains a dominant position throughout Canada; US-2014 is present in British Columbia, while US-23 and US-8 are present in Ontario (Peters, 23).
Thus, the North American populations of P. infestans are mainly clonal lines. Over the past 40 years, the number of detected clonal genotypes has reached 24. Despite the fact that strains of both types of mating are present in the population, the probability of the appearance of new genotypes as a result of sexual recombination remains quite low. Nevertheless, in the last 20 years, several cases of the appearance of ephemeral recombinant populations have been recorded (Gavino et al., 2000; Danies et al., 2014; Peters et al., 2014), and in one case, the result of crossing was the genotype US-11 , which was entrenched in North America for many years (Gavino et al., 2000). Until 2009, changes in the structure of populations were associated with the emergence of new, more aggressive genotypes with their subsequent migration and displacement of previously dominant predecessors. What happened in 2009-2010 In the USA and Canada, epiphytotics for the first time showed that in the era of globalization, outbreaks of the disease can be associated with the active spread of new genotypes when selling infected planting material.
South America
Until recently, studies of the South American populations of P. infestans were neither regular nor large-scale. It is known that the structure of these populations is quite simple and includes 1-5 clonal lineages per country (Forbes et al., 1998). So, by 1998, the genotypes US-1 (Brazil, Chile) BR-1 (Brazil, Bolivia, Uruguay, Paraguay), EC-1 (Ecuador, Colombia, Peru and Venezuela), AR-1, AR -2, AR-3, AR-4 and AR-5 (Argentina), PE-3 and PE-7 (southern Peru). Mating type A2 was present in Brazil, Bolivia and Argentina and was not found beyond the Bolivian-Peruvian border in the area of Lake Titicaca, behind which the EC-1 A1 genotype dominated in the Andes. On tomatoes, US-1 remained the dominant genotype throughout South America.
The situation more or less persisted in the 2000s. An important point was the discovery of a new clonal line EC-2 of the A2 type on wild relatives of potatoes (S. brevifolium and S. tetrapetalum) in the Northern Andes (Oliva et al., 2010). Phylogenetic studies have shown that this line is not completely identical to P. infestans, although it is closely related to it, in this connection it was proposed to consider it, as well as another line, EC-3, isolated from the tomato tree S. betaceum growing in the Andes, a new species called P. andina; however, the status of this species (an independent species or a hybrid of P. infestans with some still unknown line) is still unclear (Delgado et al., 2013).
Currently, all South American populations of P. infestans are clonal. Despite the presence of both types of mating, no recombinant populations have been identified. On tomatoes, the US-1 genotype is ubiquitous, apparently displaced from potatoes by local strains, the exact origin of which is still unknown. In Brazil, Bolivia and Uruguay the BR-1 genotype is present; in Peru, along with US-1 and EC-1, there are several other local genotypes. In the Andes, the dominant position is retained by the clonal line EC-1, the relationship of which with the recently discovered P. andina remains unexplored. The only "unstable" place where for the period 2003-2013. there were significant changes in the population, became Chile (Acuña et al., 2012), where in 2004-2005. the pathogen population became characterized by resistance to metalaxyl and a new mitochondrial DNA haplotype (Ia instead of the previously present Ib). 2006 to 2011 In the population, genotype 21 (according to SSR) dominated, the share of which reached 90%, after which the palm passed to genotype 20, the frequency of occurrence of which in the next two years was kept at about 67% (Acuña, 2015).
Europe
In the history of Europe, there have been at least two waves of migration of P. infestans from North America: in the 1th century. (HERB-1) and early 70th century (US-1). The ubiquitous distribution of metalaxyl-containing fungicides in the XNUMXs. led to the displacement of the dominant genotype US-XNUMX and its replacement with new genotypes. As a result, in most countries of Western Europe, populations of the pathogen were represented mainly by several clonal lines.
The use of microsatellite analysis for the analysis of pathogen populations made it possible to reveal serious changes that occurred in Western Europe in 2005-2008. In 2005, a new clonal line was discovered in the UK, called 13_A2 (or “Blue 13”) and characterized by the A2 mating type , high aggressiveness and resistance to phenylamides (Shaw et al., 2007). The same genotype was found in samples collected in 2004 in the Netherlands and northern France, which suggested that it migrated to the UK from continental Europe, possibly with seed potatoes (Cooke et al., 2007). The study of the genome of representatives of this clonal line showed a high degree of polymorphism of its sequence (by 2016, the number of its subclonal variations reached 340) and a significant degree of variation in the level of gene expression, incl. effector genes during plant infection (Cooke et al., 2012; Cooke, 2017). These features, along with the increased duration of the biotrophic phase, could cause an increased aggressiveness of 13_A2 and its ability to infect even potato varieties resistant to late blight.
In the next few years, the genotype rapidly spread across the countries of Northwestern Europe (Great Britain, Ireland, France, Belgium, the Netherlands, Germany) with the simultaneous displacement of the previously dominant genotypes 1_A1, 2_A1, 8_A1 (Montarry et al., 2010; Gisi et al. , 2011; Van den Bosch et al., 2011; Cooke, 2015; Cooke, 2017). According to the website www.euroblight.net, the share of 13_A2 in the populations of these countries reached 60-80% and more; the presence of this genotype has also been recorded in some countries of Eastern and Southern Europe. However, in 2009-2012. 13_A2 lost its dominant positions in Great Britain and France, yielding to the 6_A1 line (8_A1 in Ireland), and in the Netherlands and Belgium it was partially replaced by genotypes 1_A1, 6_A1, and 33_A2 (Cooke et al., 2012; Cooke, 2017; Stellingwerf, 2017).
To date, about 70% of the Western European population of P. infestans is monoclonal. According to the website www.euroblight.net, the dominant genotypes in the countries of North-Western Europe (UK, France,
Netherlands, Belgium) remain, in approximately equal proportions, 13_A2 and 6_A1, and the latter practically does not occur outside the specified region (with the exception of Ireland), but already has at least 58 subclones (Cooke, 2017). Variations 13_A2 are present in noticeable numbers in Germany, and are also sporadically observed in the countries of Central and Southern Europe. Genotype 1_A1 makes up a significant part of the populations of Belgium and partially the Netherlands and France. Genotype 8_A1 has stabilized in the European population at the level of 3-6%, with the exception of Ireland, where it retains its leading position and is divided into two subclones (Stellingwerf, 2017). Finally, in 2016, an increase in the frequency of occurrence of new genotypes 36_A2 and 37_A2, first recorded in 2013-2014, was noted; to date, these genotypes are found in the Netherlands and Belgium and partly in France and Germany, as well as in the southern part of Great Britain (Cooke, 2017). Approximately 20-30% of the Western European population is represented by unique genotypes every year.
Unlike Western Europe, by the time the 13_A2 genotype appeared, the populations of Northern Europe (Sweden, Norway, Denmark, Finland) were represented not by clonal lines, but by a large number of unique genotypes (Brurberg et al.,
2011). During the period of active spread of 13_A2 in Western Europe, the presence of this genotype in Scandinavia was not noted until 2011, when it was first discovered in North Jutland (Denmark), where mainly industrial potato varieties are grown with the active use of metalaxyl-containing fungicides (Nielsen et al., 2014). According to www.euroblight.net, genotype 13_A2 was also detected in several samples from Norway and Denmark in 2014 and in several Norwegian samples in 2016; in addition, in 2013 in Finland, a small amount of the 6_A1 genotype was observed. The main reason for the failure of 13_A2 and other clonal lines in the conquest of Scandinavia is considered to be the climatic differences of this region from the countries of Western Europe.
In addition to the fact that cool summers and cold winters contribute to the survival of not so much vegetative mycelium as oospores (Sjöholm et al., 2013), soil freezing in winter (which usually does not occur in warmer countries of Western Europe) contributes to the synchronization of oospores germination and planting. potato, which enhances their role as a source of primary infection (Brurberg et al., 2011). It should also be noted that, in northern conditions, the development of infection from oospores outstrips the development of tuberous infection, which ultimately prevents the dominance of even more aggressive, but later developed clonal lines (Yuen, 2012). The structure of the most studied populations of P. infestans in Eastern Europe (Poland, the Baltic States) is very similar to that in Scandinavia.
Both types of mating are also present here, and the vast majority of genotypes determined by SSR analysis are unique (Chmielarz et al., 2014; Runno-Paurson et al., 2016). As in Northern Europe, the distribution of clonal lines (primarily of the 13_A2 genotype) practically did not affect the local populations of the pathogen, which retain a high level of diversity with the absence of pronounced dominant lines.
The presence of 13_A2 is occasionally observed in fields with commercial potato varieties. In Russia, the situation is developing in a similar way. Microsatellite analysis of P. infestans isolates collected in 2008-2011 in 10 different regions of the European part of Russia, showed a high degree of genotypic diversity and a complete lack of coincidences with European clonal lines (Statsyuk et al., 2014). Several years later, a study of P. infestans samples collected in the Leningrad region in 2013-2014 showed significant differences between them and the genotypes from this region identified in the previous study. In both studies, Western European genotypes were not found (Beketova et al., 2014; Kuznetsova et al., 2016).
The high genetic diversity of the Eastern European populations of P. infestans and the absence of dominant clonal lines in them may be due to several reasons. First, as in Northern Europe, the climatic conditions of the considered countries contribute to the formation of oospores as a primary source of infection (Ulanova et al., 2010; Chmielarz et al., 2014). Second, a significant proportion of potatoes produced in these countries are grown on small private farms, often surrounded by forests or other obstacles to the free movement of infectious material (Chmielarz et al., 2014). As a rule, potatoes grown in such conditions are practically not treated with chemicals, and the choice of varieties is based on their late blight resistance, i.e. there is no selective pressure for aggressiveness and resistance to metalaxyl, which deprives resistant genotypes, such as 13_A2, of advantages over other genotypes (Chmielarz et al., 2014). Finally, due to the small size of land plots, their owners usually do not practice crop rotation, growing potatoes in the same place for years, which contributes to the accumulation of a genetically diverse inoculum (Runno-Paurson et al., 2016; Elansky, 2015; Elansky et al. ., 2015).
Asia
Until recently, the structure of P. infestans populations in Asia remained relatively poorly understood. It was known that it is represented mainly by clonal lines, and the effect of sexual recombination on the emergence of new genotypes is very small. So, for example, in 1997-1998. In the Asian part of Russia (Siberia and the Far East), the pathogen population was represented by only three genotypes with a predominance of the SIB-1 genotype (Elansky et al., 2001). The presence of clonal pathogen lines has been shown in countries such as China, Japan, Korea, the Philippines, and Taiwan (Koh et al., 1994; Chen et al., 2009). The clonal line US-1 dominated over a large territory of Asia in the late 90s - early 2000s. almost everywhere began to be replaced by other genotypes, which, in turn, gave way to new ones. In most cases, changes in the structure and composition of populations in Asian countries were associated with the migration of new genotypes from outside. Thus, in Japan, with the exception of the JP-3 genotype, all other Japanese genotypes that appeared after US-1 (JP-1, JP-2, JP-3) have more or less proven external origin (Akino et al., 2011) ... There are currently three main pathogen populations in China, with a clear geographical division; There is no or very weak gene flow between these populations (Guo et al., 2010; Li et al., 2013b). Genotype 13_A2 appeared on the territory of China in its southern provinces (Yunnan and Sichuan) in 2005-2007, and in 2012-1014. was also seen in the northeast of the country (Li et al., 2013b). In India, 13_A2 appeared presumably at the same time as in China, most likely with infected seed potatoes (Chowdappa et al., 2015), and in 2009-2010. caused a serious epiphytosis of late blight on tomato in the south of the country, after which it spread to potatoes and in 2014 caused an outbreak of late blight in West Bengal, which led to the ruin and suicide of many local farmers (Fry, 2016).
Africa
Until 2008-2010 systematic studies of P. infestans in African countries have not been carried out. At the moment, the African populations of P. infestans can be divided into two groups, and this division is clearly associated with the fact of the import of seed potatoes from Europe.
In North Africa, which actively imports seed potatoes from Europe, the A2 mating type is widely represented in almost all regions, which provides a theoretical possibility of the emergence of new genotypes as a result of sexual recombination (Corbière et al., 2010; Rekad et al., 2017). In addition, in Algeria, the presence of genotypes 13_A2, 2_A1, and 23_A1 is noted with a pronounced dominance of the first of them, as well as a gradual decrease in the proportion of unique genotypes until complete disappearance (Rekad et al., 2017). In contrast to the rest of the region, in Tunisia (with the exception of the north-east of the country), the pathogen population is represented mainly by the A1 mating type (Harbaoui et al., 2014).
The clonal line NA-01 is dominant here. In general, the proportion of clonal lines in the population is only 43%. In Eastern and Southern Africa, where the volume of seed imports is vanishingly small (Fry et al., 2009), P. infestans is represented by only two clonal A1-type lines, US-1 and KE-1, and the latter actively displaces the former on potatoes ( Pule et al., 2012; Njoroge et al., 2016). To date, both of these genotypes have a noticeable number of subclonal variations.
Australia
The first report of late blight on potatoes in Australia dates back to 1907, and the first epiphytotia, presumably caused by heavy rains in the summer months, occurred in 1909-1911. (Drenth et al., 2002). In general, however, late blight has no significant economic significance for the country. Sporadic outbreaks of late blight, provoked by weather conditions that provide high humidity, do not occur more often than once every 5-7 years and are localized mainly in northern Tasmania and central Victoria. In connection with the above, publications devoted to the study of the structure of the Australian population of P. infestans are practically absent. The latest available information is from 1998-2000. (Drenth et al., 2002). According to the authors, the population of the state of Victoria was a clonal lineage US-1.3, which indirectly confirmed the migration of this genotype from the United States. The Tasmanian specimens were classified as AU-3, different from the genotypes that were present at that time in other parts of the world.
Features of the development of late blight in Russia
In Europe, an infection introduced with diseased seed tubers, oospores that overwintered in the soil, as well as zoosporangia brought by the wind from plants grown from overwintered tubers on last year's fields ("volunteer" plants), or on heaps of culled ones, are considered as the primary inoculum on potatoes. bookmark for storage of tubers. Of these, plants grown on heaps of discarded tubers are considered the most dangerous source of infection. there, the number of sprouted tubers is often significant, and zoosporangia can be carried from them over long distances. The rest of the sources (oospores, "volunteer" plants) are not so dangerous, because it is not customary to grow plants in the same fields more often than once every 3-4 years. Infection from diseased seed tubers is also minimal due to a good seed quality control system.
In general, the amount of inoculum in European populations is limited, and therefore the increase in the epidemic is rather slow and can be successfully controlled using chemical fungicidal preparations. The main task in European conditions is the fight against infection in the phase when the mass dispersal of zoosporangia from affected plants begins.
In Russia, the situation is radically different. Most of the potato and tomato crop is grown in small private gardens; protective measures are either not carried out on them at all, or fungicidal treatments are carried out in an insufficient number and begin after the appearance of late blight on the tops. As a result, private vegetable gardens act as the main source of infection, from which zoosporangia are carried by the wind to commercial plantings. This is confirmed by our direct observations in Moscow, Bryansk, Kostroma, Ryazan regions: damage to plants in private gardens is observed even before the start of fungicide treatments of commercial plantings. Subsequently, the epidemic in large fields is restrained by the use of fungicidal preparations, while in private gardens there is a rapid development of late blight.
In the case of incorrect or "budgetary" treatments of commercial plantings, foci of late blight appear in the fields; later they are actively developing, covering ever larger areas (Elansky, 2015). Infection in private gardens has a significant impact on epidemics in commercial fields. In all potato-growing regions of Russia, the area occupied by potatoes in private gardens is several times larger than the total area of fields of large producers. In such an environment, private vegetable gardens can be viewed as a global inoculum resource for commercial fields. Let's try to identify those properties that are characteristic of the genotypes of strains in private gardens.
Planting non-seed and quarantine control of ware potatoes, tomato seeds obtained from dubious foreign producers, long-term cultivation of potatoes and tomatoes on the same areas, improper fungicide treatments or their complete absence lead to severe epiphytoties in the private sector, the result of which is free crossing, hybridization and the formation of oospores in private gardens. As a result, a very high genotypic diversity of the pathogen is observed, when almost every strain is unique in its genotype (Elansky et al., 2001, 2015). Planting seed potatoes of various genetic origins makes it unlikely that clonal lines specialized to attack a particular variety will emerge. The strains selected in such a case are distinguished by their versatility in relation to the affected varieties, most of them have a close to maximum number of virulence genes. This is very different from the system of "clonal lines" typical for large fields of agricultural enterprises with a properly installed system of protection against late blight. "Clonal lines" (when all strains of the late blight pathogen in the field are represented by one or more genotypes) are ubiquitous in countries where potato growing is carried out exclusively by large farms: the USA, the Netherlands, Denmark, etc. In England, Ireland, Poland, where household plots are also traditionally widespread potato growing, there is also a higher genotypic diversity in private gardens. At the end of the 20th century, "clonal lines" were widespread in the Asian and Far Eastern parts of Russia (Elansky et al., 2001), which is apparently due to the use of the same varieties of potatoes exclusively for planting. Recently, the situation in these regions also began to change towards an increase in the genotypic diversity of populations.
The lack of intensive treatments with fungicidal preparations has another, direct consequence - there is no accumulation of resistant strains in the gardens. Indeed, our results show that metalaxyl-resistant strains are found much less frequently in private gardens than in commercial plantings.
The close proximity of potato and tomato plantings, typical for private gardens, facilitates the migration of strains between these crops, as a result of which, in the last decade, among the strains isolated from potatoes, the proportion of strains carrying the gene for resistance to varieties of cherry tomato (T1), previously characteristic only for " tomato "strains. Strains with the T1 gene in most cases are highly aggressive towards both potatoes and tomatoes.
In recent years, late blight on tomato began to appear in many cases earlier than on potatoes. Tomato seedlings can be infested with oospores in the soil, or oospores present in tomato seeds or adhering to them (Rubin et al., 2001). In the last 15 years, a large number of inexpensive packaged seeds, mainly imported, have appeared in stores, and most of the small producers have switched to using them. The seeds may contain strains with genotypes typical of the regions of their cultivation. In the future, these genotypes are included in the sexual process in private gardens, which leads to the emergence of completely new genotypes.
Thus, it can be stated that private gardens are a global "melting pot" in which, as a result of the exchange of genetic material, existing genotypes are processed and completely new ones appear. Moreover, their selection takes place under conditions that are very different from those created for potatoes in large farms: the absence of fungicidal press, varietal uniformity of plantings, the predominance of plants affected by various forms of viral and bacterial infection, proximity to tomatoes and wild nightshades, active crossing and oospore formation, the possibility for oospores to act as a source of infection for the next year.
All this leads to a very high genotypic diversity of backyard populations. In the conditions of epiphytotics in vegetable gardens, late blight spreads very quickly and huge amounts of spores are released, flying to nearby commercial plantings. However, having entered commercial fields with the correct system of agricultural technology and chemical protection, the spores that have arrived have practically no opportunity to initiate epiphytotics in the field, which is due to the absence of clonal lines that are resistant to fungicides and specialized to the cultivated variety.
Another source of primary inoculum may be diseased tubers trapped in commercial seedlings. These tubers were grown, as a rule, in fields with good agricultural technology and intensive chemical protection. The genotypes of the isolates that affected the tubers are adapted to the development of their own variety. These strains are significantly more dangerous for commercial planting than inoculum originating from private gardens. The results of our studies also support this assumption. Populations isolated from large fields with properly conducted chemical protection and good agricultural technology do not differ in high genotypic diversity. Often these are several clonal lines that are highly aggressive.
Strains from commercial seed material can enter populations in vegetable gardens and be involved in the processes going on in them. However, in a vegetable garden, their competitiveness will be much lower than in a commercial field, and soon they will cease to exist in the form of a clonal line, but their genes can be used in the “garden” population.
The infection that develops on "volunteer" plants and on heaps of culled tubers during harvesting is not so relevant for Russia, because In the main potato-growing regions of Russia, deep winter soil freezing is observed, and plants from tubers that have wintered in the soil rarely develop. Moreover, as our experiments show, the late blight pathogen does not survive at negative temperatures even on tubers that have retained their viability. In the arid zone, where the cultivation of early potatoes is practiced, late blight is quite rare due to the dry and hot growing season.
Thus, we are currently observing the division of P. infestans populations into “field” and “garden” populations. However, in recent years, processes have been observed leading to the convergence and interpenetration of genotypes from these populations.
Among them, one can note a general increase in the literacy of small producers, the emergence of affordable small packages of seed potatoes, the spread of fungicidal preparations in small packages, and the loss of fear of “chemistry” by the population.
Situations arise when, thanks to the vigorous activity of one supplier, entire villages are planted with seed tubers of the same variety and provided with small packages of the same pesticides. It can be assumed that potatoes of the same variety will be found on commercial plantings nearby.
On the other hand, some pesticide trading companies are promoting "budgetary" chemical treatment schemes. In this case, the number of recommended treatments is underestimated and the cheapest fungicides are offered, and the emphasis is not on preventing the development of late blight up to mowing the tops, but on a certain delay in epiphytoty in order to increase the yield. Such schemes are economically justified when growing ware potatoes from low-grade seed material, when in principle there is no question of obtaining a high yield. However, in this case, in contrast to garden populations, the leveled genetic background of the potato contributes to the selection of specific physiological races, which are very dangerous for this variety.
In general, the tendencies towards convergence of "garden" and "field" methods of potato production seem to us rather dangerous. To prevent their negative consequences, both in the home and commercial sectors, it will be necessary to control both the assortment of seed potatoes and the range of fungicides offered to private owners in small packaging, as well as tracing potato protection schemes and the use of fungicides in the commercial sector.
In the areas of the private sector, there is an intensive development of not only late blight, but also Alternaria. Most owners of private plots do not take special measures to protect against Alternaria, mistaking the development of Alternaria for the natural wilting of the tops or the development of late blight. Therefore, with the massive development of Alternaria on susceptible varieties, household plots can serve as a source of inoculum for commercial plantings.
Mechanisms of variability
Mutation process
Since the occurrence of mutations is a random process proceeding with a low frequency, the occurrence of mutations at any locus depends on the frequency of mutation of this locus and the size of the population. When studying the frequency of mutations of P. infestans strains, the number of colonies grown on selective nutrient media after treatment with chemical or physical mutagens is usually determined. As can be seen from the data presented in Table 8, the mutation frequency of the same strain at different loci can differ by several orders of magnitude. The high frequency of mutations in resistance to metalaxyl may be one of the reasons for the accumulation of strains resistant to it in nature.
The frequency of spontaneous or induced mutations, calculated on the basis of laboratory experiments, does not always correspond to the processes occurring in natural populations, for the following reasons:
1. With asynchronous nuclear fissions, it is impossible to estimate the frequency of mutations per one nuclear generation. Therefore, most experiments provide information only directly about the frequency of mutations, without distinguishing between two mutational events and one event following mitosis.
2. Single-step mutations usually reduce the balance of the genome, therefore, along with the acquisition of a new property, the general fitness of the organism decreases. Most of the experimentally obtained mutations have a reduced aggressiveness and are not recorded in natural populations. Thus, the correlation coefficient between the degree of resistance of P. infestans mutants to phenylamide fungicides and the growth rate on an artificial medium was on average (-0,62), and the resistance to fungicides and aggressiveness on potato leaves (-0,65) (Derevyagina et al. , 1993), which indicates the low fitness of the mutants. Mutations in resistance to dimethomorph were also accompanied by a sharp decrease in viability (Bagirova et al., 2001).
3. The majority of spontaneous and induced mutations are recessive and do not manifest themselves phenotypically in experiments, but constitute a hidden reserve of variability in natural populations. Mutant strains isolated in laboratory experiments carry dominant or semi-dominant mutations (Kulish and Dyakov, 1979). Apparently, nuclear diploidy explains unsuccessful attempts to obtain mutants under the influence of UV irradiation that are virulent on previously resistant varieties (McKee, 1969). According to the author's calculations, such mutations can occur with a frequency of less than 1: 500000. The transition of recessive mutations to a homozygous, phenotypically expressed state can occur due to sexual or asexual recombination (see below). However, even in this case, the mutation can be masked by the dominant alleles of the wild-type nuclei in the cenotic (multinucleated) mycelium and phenotypically fixed only during the formation of mononuclear zoospores.
Table 8. Frequency of P. infestans mutations to growth-inhibiting substances under the action of nitrosomethylurea (Dolgova, Dyakov, 1986; Bagirova et al., 2001)
Connection | Mutation frequency |
Oxytetracycline | X 6,9 10-8 |
Blasticidin S | 7,2 x 10-8 |
Streptomycin | 8,3 х10-8 |
Trichothecin | X 1,8 10-8 |
Cycloheximide | X 2,1 10-8 |
Daaconil | <4 x 10-8 |
Dimethomorph | X 6,3 10-7 |
Metalaxil | X 6,9 10-6 |
Population sizes also play a decisive role in the occurrence of spontaneous mutations. In very large populations, in which the number of cells N> 1 / a, where a is the mutation rate, mutation ceases to be a random phenomenon (Kvitko, 1974).
Calculations show that with an average infestation of a potato field (35 spots per plant), 8x1012 spores are formed daily on one hectare (Dyakov and Suprun, 1984). Apparently, such populations contain all mutations allowed by the type of exchange at each locus. Even a rare mutation, occurring with a frequency of 10-9, will be acquired by a thousand individuals out of millions living on one hectare of a potato field. For mutations occurring with a higher frequency (for example, 10-6), in such a population, various paired mutations can occur daily (simultaneously at two loci), i.e. the mutation process will replace recombination.
Migrations
For P. infestans, two main types of migration are known: to close distances (within a potato field or neighboring fields) by spreading zoosporangia by air currents or rain spray, and to long distances - with planting tubers or transported tomato fruits. The first method provides for the expansion of the focus of the disease, the second - the creation of new foci in places remote from the primary.
The spread of infection with tomato tubers and fruits not only contributes to the emergence of the disease in new places, but is also the main source of genetic diversity in populations. In the Moscow region, potatoes are grown, brought from different regions of Russia and Western Europe. Tomato fruits are brought from the southern regions of Russia (Astrakhan region, Krasnodar region, North Caucasus). Tomato seeds, which can also serve as sources of infection (Rubin et al., 2001), are also imported from the southern regions of Russia, China, European countries and other countries.
According to calculations by E. Mayr (1974), genetic changes in a local population caused by mutations rarely exceed 10-5 per locus, while in open populations, the exchange due to the counter flow of genes is at least 10-3 - 10-4.
Migration in infected tubers is responsible for the entry of P. infestans into Europe, spreading to all regions of the world where potatoes are grown; they caused the most serious population changes. Late blight on potatoes appeared on the territory of the Russian Empire almost simultaneously with its appearance in Western Europe.
Since the disease was first noted in 1846-1847 in the Baltic States and only in subsequent years spread in Belarus and the northwestern regions of Russia, its Western European origin is obvious. The first source of late blight in the Old World is not so obvious. The hypothesis developed by Fry et al. (Fry et al., 1992; Fry, Goodwin, 1995, Goodwin et al., 1994) suggests that the parasite first came from Mexico to North America, where it spread through crops, and then was transported to Western Europe (fig. 7).
As a result of the repeated drift (double effect of the "bottleneck"), single clones got to Europe, the offspring of which caused a pandemic throughout the territory of the Old World where potatoes are grown. As evidence for this hypothesis, the authors cite, firstly, the ubiquitous occurrence of only one type of mating (A1) and, secondly, the homogeneity of the genotypes of the studied strains from different regions (all of them are based on molecular markers, including 2 isozyme loci, DNA fingerprinting patterns, and the structure of mitochondrial DNA are identical, and correspond to the clone US-1 described in the USA). However, some data raise doubts about at least some of the provisions of the stated hypothesis. Analysis of P. infestans mitochondrial DNA isolated from herbarium potato samples infected during the first epiphytotic period in the 40s showed that they differ in the structure of mitochondrial DNA from clone US-1, which, therefore, was at least not the only source of infection in Europe (Ristaino et al, 2001).
The late blight situation worsened again in the 80s of the XX century. The following changes have occurred:
1) The average aggressiveness of the population has increased, which has led, in particular, to the widespread spread of the most harmful form of late blight - damage to the petioles and stems.
2) There was a shift in the time of late blight on potatoes - from late July to early July and even to the end of June.
3) The A2 mating type, which was previously absent in the Old World, has become ubiquitous.
The changes were preceded by two events: the massive use of the new fungicide metalaxyl (Schwinn and Staub, 1980) and the emergence of Mexico as a world exporter of potatoes (Niederhauser, 1993). In accordance with this, two reasons for population changes were put forward: conversion of the mating type under the influence of metalaxyl (Ko, 1994) and the massive introduction of new strains with infected tubers from Mexico (Fry and Goodwin, 1995). Although interconversions of mating types under the influence of metalaxyl were obtained not only by Ko, but also in works carried out in the laboratory of Moscow State University (Savenkova, Chherepennicova-Anikina, 2002), the second hypothesis is preferable. Along with the appearance of the second type of mating, serious changes took place in the genotypes of Russian P. infestans strains, including in neutral genes (isozyme and RFLP loci), as well as in the structure of mitochondrial DNA. The complex of these changes cannot be explained by the action of metalaxyl; rather, there was a massive import of new strains from Mexico, which, being more aggressive (Kato et al., 1997), displaced the old strains (US-1), becoming dominant in the populations. The change in the composition of European populations took place in a very short time - from 1980 to 1985 (Fry et al., 1992). On the territory of the former USSR, “new strains” were found in collections from Estonia in 1985, that is, earlier than in Poland and Germany (Goodwin et al., 1994). The last time the "old strain US-1" in Russia was isolated from an infected tomato in the Moscow region in 1993 (Dolgova et al., 1997). Also in France, “old” strains were found in tomato plantings until the early 90s, that is, after they had long disappeared on potatoes (Leberton and Andrivon, 1998). Changes in P. infestans strains affected many traits, including those of great practical importance, and increased the harmfulness of late blight.
Sexual recombination
In order for sexual recombination to contribute to the variability, it is necessary, firstly, the presence of two types of mating in the population in a ratio close to 1: 1, and, secondly, the presence of initial population variability.
The ratio of mating types varies greatly in different populations and even in different years in one population (Table 9,10, 90). The reasons for such drastic changes in the frequency of mating types in populations (as, for example, in Russia or in Israel in the early 2002s of the last century) are unknown, but it is believed that this is due to the introduction of more competitive clones (Cohen, XNUMX).
Some indirect data indicate the course of the sexual process in certain years and in certain regions:
1) Studies of populations from the Moscow region showed that in 13 populations in which the share of A2 mating type was less than 10%, the total genetic diversity calculated for three isozyme loci was 0,08, and in 14 populations in which the share of A2 exceeded 30%, genetic diversity was twice as high (0,15) (Elansky et al., 1999). Thus, the higher the probability of sexual intercourse, the greater the genetic diversity of the population.
2) The relationship between the ratio of mating types in populations and the intensity of oospore formation was observed in Israel (Cohen et al., 1997) and in the Netherlands
(Flier et al., 2004). Our studies showed that in populations in which isolates with the A2 mating type accounted for 62, 17, 9, and 6%, oospores were found in 78, 50, 30, and 15% of the analyzed potato leaves (having 2 or more spots), respectively.
Samples with 2 or more spots significantly more often contained oospores than samples with 1 spot (32 and 14% of samples, respectively) (Apryshko et al., 2004).
Oospores were much more common in the leaves of the middle and lower layer of the potato plant (Mytsa et al., 2015; Elansky et al., 2016).
3) In some regions, unique genotypes have been discovered, the occurrence of which is associated with sexual recombination. Thus, in Poland in 1989 and in France in 1990, strains homozygous for the glucose-6-
phosphate isomerase (GPI 90/90). Since previously only 10/90 heterozygotes were encountered for 100 years, homozygosity is attributed to sexual recombination (Sujkowski et al., 1994). In Colombia (USA), isolates combining A2 with GPI 100/110 and A1 with GPI 100/100 are common, but at the end of the 1994 season (August 16 and September 9), strains with recombinant genotypes (A1 GPI 100/110 and A2 GPI 100/100) (Miller et al., 1997).
4) In some populations from Poland (Sujkowski et al., 1994) and the North Caucasus (Amatkhanova et al., 2004), the distribution of fingerprint DNA loci and allozyme protein loci corresponds to the Hardy-Weinberg distribution, which indicates
about the high share of the contribution of sexual recombination to the variability of populations. In other regions of Russia, no correspondence to the Hardy-Weinberg distribution in populations was found, but the presence of linkage disequilibrium was shown, indicating the predominance of clonal reproduction (Elansky et al., 1999).
5) Genetic diversity (GST) between strains with different mating types (A1 and A2) was lower than between different populations (Sujkowski et al., 1994), which indirectly indicates sexual crosses.
At the same time, the contribution of sexual recombination to population diversity cannot be very high. This contribution was calculated for the populations of the Moscow region (Elansky et al., 1999). According to the calculations of Lewontin (1979), "recombination, which can produce new variants from two loci with a frequency not exceeding the product of their heterozygosities, becomes effective only if the values of heterozygosity for both alleles are already high."
With the ratio of the two types of pairing, which is typical for the Moscow region, equal to 4: 1, the recombination frequency will be 0,25. The probability that crossed strains will be heterozygous for two of the three studied isozygous loci in the studied populations was 0,01 (2 strains out of 177). Therefore, the probability of occurrence of double heterozygotes as a result of recombination should not exceed their product multiplied by the probability of crossing (0,25x0,02x0,02) = 10-4, i.e. sexual recombinants usually do not fall into the studied sample of strains. These calculations were made for populations from the Moscow region characterized by relatively high variability. In monomorphic populations like the Siberian ones, the sexual process, even if it occurs in individual populations, cannot influence their genetic diversity.
In addition, P. infestans is characterized by frequent chromosome misalignment in meiosis, which leads to aneuploidy (Carter et al., 1999). Such violations reduce the fertility of the hybrids.
Parasexual recombination, mitotic gene conversion
In experiments on the splicing of P. infestans strains with mutations in resistance to different growth inhibitors, the emergence of misolates resistant to both inhibitors was found (Shattock and Shaw, 1975; Dyakov, Kuzovnikova, 1974; Kulish, Dyakov,
1979). Strains resistant to two growth inhibitors arose as a result of heterokaryotization of the mycelium, and in this case, they cleaved during reproduction by mononuclear zoospores (Judelson, Ge Yang, 1998), or did not cleave in monozoosporous offspring, because they had tetraploid (since the initial isolates are diploid) nuclei (K , 1979). Heterozygous diploids segregated at a very low frequency due to haploidization, chromosome nondisjunction, and mitotic crossing over (Poedinok et al., 1982). The frequency of these processes could be increased with the help of certain actions on heterozygous diploids (for example, UV irradiation of germinating spores).
Although the formation of vegetative hybrids with double resistance occurs not only in vitro, but also in potato tubers infected with a mixture of mutants (Kulish et al., 1978), it is rather difficult to assess the role of parasexual recombination in the generation of new genotypes in populations. The frequency of segregants formation due to haploidization, nondisjunction of chromosomes and mitotic crossing over without special effects is negligible (less than 10-3).
The emergence of homozygous segregants of heterozygous strains may be based on both mitotic crossing over and mitotic gene conversion, which in P. sojae occurs with a frequency of 3 x 10-2 to 5 x 10-5 per locus, depending on the strain (Chamnanpunt et al. , 2001).
Although the frequency of occurrence of heterokaryons and heterozygous diploids turned out to be unexpectedly high (reaching tens of percent), this process occurs only when mutant cultures obtained from the same strain are spliced. When using different strains isolated from nature, heterokaryotization does not occur (or occurs with a very low frequency) due to the presence of vegetative incompatibility (Poedinok and Dyakov, 1981; Anikina et al., 1997b; Cherepennikova-Anikina et al., 2002). Consequently, the role of parasexual recombination can be reduced only to intraclonal recombination in heterozygous nuclei and the transition of individual genes to a homozygous state without a sexual process. This process may be of epidemiological significance in strains with recessive or semi-dominant fungicide resistance mutations. Its transition to a homozygous state due to the parasexual process will increase the resistance of the carrier of the mutation (Dolgova, Dyakov, 1986).
Introgression of genes
Heterothallic species Phytophthora are capable of interbreeding with the formation of hybrid oospores (see Vorob'eva and Gridnev, 1983; Sansome et al., 1991; Veld et al., 1998). The natural hybrid of the two Phytophthora species was so aggressive that it killed thousands of alders in the UK (Brasier et al., 1999). P. infestans can occur with other species of the genus (P. erythroseptica, P. nicotianae, P. Cactorum, etc.) on common host plants and in the soil, but there is little information in the literature about the possibility of interspecific hybrids. Under laboratory conditions, hybrids between P. infestans and P. Mirabilis were obtained (Goodwin and Fry, 1994).
Table 9. The proportion of P. infestans strains with A2 mating type in different countries of the world in the period from 1990 to 2000 (according to the data of open literature sources and sites www.euroblight.net, www.eucablight.org)
Country | 1990 | 1991 | 1992 | 1993 | 1994 | 1995 | 1996 | 1997 | 1998 | 1999 | 2000 |
---|---|---|---|---|---|---|---|---|---|---|---|
Belarus | 33 (12) | 34 (29) | |||||||||
Belgium | 15 (49 *) | 6 (66) | 20 (86) | ||||||||
Ecuador | 0 (13) | 0 (12) | 0 (19) | 0 (21) | 12 (41) | 25 (39) | 15 (75) | 22 (73) | 25 (68) | 0 (35) | |
Estonia | 8 (12) | ||||||||||
England | 4 (26) | 3 (630) | 9 (336) | ||||||||
Finland | 0 (15) | 19 (117) | 12 (16) | 21 (447) | 6 (509) | 9 (432) | 43 (550) | ||||
France | 0 (35) | 0 (56) | 0 (83) | 0 (67) | 0 (86) | 2 (135) | 7 (156) | 6 (123) | 0 (73) | 0 (285) | 0 (135) |
Hungary | 72 (32) | ||||||||||
Ireland | 4 (145) | ||||||||||
North. Ireland | 10 (41) | 9 (58) | 1 (106) | 0 (185) | 0 (18) | 0 (56) | 0 (35) | 0 (26) | |||
Netherlands | 7 (41) | 5 (276) | 24 (377) | 44 (353) | 23 (185) | ||||||
Norway | 25 (446) | 28 (156) | 8 (39) | 18 (257) | 38 (197) | ||||||
Peru | 0 (34, 1984 -86) | 0 (287, 1997-98) | 0 (112) | 0 (66) | |||||||
Poland | 19 (180) | 21 (142) | 33 (256) | 26 (149) | 35 (70) | ||||||
Scotland | 25 (147) | 11 (163) | 22 (189) | 5 (22) | |||||||
Sweden | 25 (263) | 62 (258) | 49 (163) | ||||||||
Wales | 0 (16) | 7 (97) | 0 (48) | 0 (25) | |||||||
Korea | 36 (42) | 10 (130) | 15 (98) | ||||||||
China | 20 (142, 1995-98) | 0 (6) | 0 (8) | 0 (35) | |||||||
Colombia | 0 (40, 1994-2000) | ||||||||||
Uruguay | 100 (25, 1998-99) | ||||||||||
Morocco | 60 (108, 1997-2000) | 52 (25) | 42 (40) | ||||||||
Serbia | 76 (37) | ||||||||||
Mexico (Toluca) | 28 (292, 1988-89) | 50 (389, 1997-98) |
Table 10. The proportion of P. infestans strains with A2 mating type in different countries of the world in the period from 2000 to 2011
Country | 2001 | 2002 | 2003 | 2004 | 2005 | 2006 | 2007 | 2008 | 2009 | 2010 | 2011 |
---|---|---|---|---|---|---|---|---|---|---|---|
Austria | 65 (83) | ||||||||||
Belarus | 42 (78) | ||||||||||
Belgium | 20 (102 *) | 4 (32) | 50 (14) | 25 (16) | 62 (13) | 54 (26) | 70 (54) | 30 (23) | 29 (35) | 62 (71) | 45 (49) |
Switzerland | 89 (19) | ||||||||||
Czech Republic | 35 (31) | 54 (64) | 38 (174) | 12 (80) | |||||||
Germany | 95 (53) | ||||||||||
Denmark | 48 (52) | ||||||||||
Ecuador | 5 (178) | 6 (108) | 9 (121) | 18 (94) | 2 (44) | 0 (66) | 5 (47) | ||||
Estonia | 54 (25) | 0 (24) | 33 (62) | 45 (140) | 25 (100) | 12 (103) | |||||
England | 4 (47) | 10 (96) | 31 (55) | 55 (790) | 68 (862) | 70 (552) | 68 (299) | ||||
Finland | 47 (162) | 12 (218) | 42 | ||||||||
France | 0 (186) | 4 (108) | 8 (61) | 22 (103) | 33 (303) | 65 (378) | 74 (331) | 75 (125) | 75 (12) | ||
Hungary | 48 (27) | 48 (90) | 9 | 7 | |||||||
North. Ireland | 0 (38) | 0 (58) | 0 (40) | 0 (24) | 5 (54) | 0 (18) | 27 (578) | 45 (239) | 36 (213) | 82 (60) | 10 (80) |
Netherlands | 66 (24) | 93 (15) | 91 (11) | ||||||||
Norway | 39 (328) | 3 (115) | 12 (19) | ||||||||
Peru | 0 (36) | ||||||||||
Poland | 25 (46) | 10 (30) | 85 (20) | 38 (44) | 75 (66) | 55 (56) | 65 (35) | 72 (81) | 85 (21) | ||
Scotland | 3 (213) | 2 (474) | 24 (135) | 86 (337) | 88 (386) | 74 (172) | |||||
Sweden | 60 (277) | 39 (87) | |||||||||
Slovakia | 0 (36) | 14 (26) | 62 (26) | 0 (26) | |||||||
Wales | 25 (12) | 68 (106) | 80 (88) | 92 (143) | 75 (45) | ||||||
Korea | 46 (26) | ||||||||||
Brazil | 0 (49) | 0 (30) | |||||||||
China | 10 (30) | 0 (6) | 0 (6) | ||||||||
Vietnam | 0 (294, 2003-04) | ||||||||||
Uganda | 0 (8) |
Dynamics of the genotypic composition of populations
Changes in the genotypic composition of P. infestans populations can occur under the influence of migration of new clones from other regions, agricultural practices (change of varieties, application of fungicides), and weather conditions. External influences affect differently clones at different stages of the life cycle; therefore, populations annually experience cyclical changes in the frequencies of genes subject to selection, due to a change in the predominant role of gene drift and selection.
Influence of the variety
New cultivars with effective genes for vertical resistance (R-genes) are a powerful selective factor that selects clones with complementary virulence genes in P. infestans populations. In the absence of nonspecific resistance in the potato variety that inhibits the growth of the pathogen population, the process of replacing the dominant clones in the population occurs very quickly. So, after the spread in the Moscow region of the Domodedovsky variety, which has the R3 resistance gene, the frequency of clones virulent for this variety increased from 0,2 to 0,82 in one year (Dyakov, Derevjagina, 2000).
However, the change in the frequencies of virulence genes (pathotypes) in populations occurs not only under the influence of cultivated potato varieties. For example, in Belarus until 1977, clones with virulence genes 1 and 4 dominated, which was caused by the cultivation of potato varieties with resistance genes R1 and R4 (Dorozhkin, Belskaya, 1979). However, at the end of the 70s of the 2002th century, clones appeared with different virulence genes and their combinations, and the complementary resistance genes were never used in potato breeding (extra virulence genes) (Ivanyuk et al., XNUMX). The reason for the appearance of such clones, apparently, is due to the migration to Europe of infectious material from Mexico with potato tubers. At home, these clones developed not only on cultivated potatoes, but also on wild species carrying a variety of resistance genes; therefore, the combination of many virulence genes in the genome was necessary for survival in those conditions.
As for varieties with nonspecific resistance, they, by reducing the rate of reproduction of the pathogen, delay the evolution of its populations, which, as already mentioned, is a function of number. Since aggressiveness is polygenic, clones containing a greater number of genes for "aggressiveness" accumulate the sooner the higher the population size. Therefore, highly aggressive races are not a product of adaptation to cultivated varieties with nonspecific resistance, but, on the contrary, are more likely to be detected in the plantings of highly susceptible varieties that are accumulators of the parasite spores.
Thus, in Russia, the most aggressive populations of P. Infestans were found in the zones of annual epiphytoties (populations from Sakhalin, Leningrad, and Bryansk regions). The aggressiveness of these populations turned out to be higher than the Mexican one (Filippov et al., 2004).
In addition, fewer oospores are formed in the leaves of resistant varieties than in susceptible ones (Hanson and Shattock, 1998), that is, the nonspecific resistance of the variety also reduces the parasite's recombination abilities and the possibility of alternative wintering methods.
Influence of fungicides
Fungicides not only reduce the number of phytopathogenic fungi, i.e. affect the quantitative characteristics of their populations, but they can also change the frequencies of individual genotypes, i.e. influence the qualitative composition of populations. Among the most important indicators of populations changing under the influence of fungicides are the following: changes in resistance to fungicides, changes in aggressiveness and virulence, and changes in breeding systems.
Influence of fungicides on the resistance and aggressiveness of populations
The degree of this influence is determined, first of all, by the type of fungicide used, which can be conditionally divided into polysite, oligosite and monosite.
The former includes most contact fungicides. Resistance to them (if it is possible at all) is controlled by a large number of very weakly expressive genes. These properties determine the absence of visible changes in the resistance of the population after treatment with fungicides (although in some experiments, some increase in resistance was obtained). The fungal population preserved after spraying with contact fungicides consists of two groups of strains:
1) Strains preserved in areas of plants not treated with the drug. Since there was no contact with the fungicide, the aggressiveness and resistance of these strains does not change.
2) Strains in contact with the fungicide, the concentration of which at the points of contact was lower than lethal. As mentioned above, the resistance of this part of the population also does not change, however, due to the partial damaging effect of the fungicide even in sublethal concentration on the metabolism of the fungal cell, the general fitness and its parasitic component, aggressiveness, decrease (Derevyagina and Dyakov, 1990).
Thus, even a part of the population that has not died, exposed to contact with the fungicide, has a weak aggressiveness and cannot be a source of epiphytotics. Therefore, careful treatment that reduces the frequency of the proportion of the population not in contact with the fungicide is a condition for the success of protective measures. Resistance to oligosite fungicides is controlled by several additive genes.
Mutation of each gene leads to some increase in resistance, and the overall degree of resistance is due to the addition of such mutations. Therefore, the increase in resistance occurs stepwise. An example of a stepwise increase in resistance are mutations in resistance to the fungicide dimethomorph, which is widely used to protect potatoes from late blight. Dimethomorph resistance is polygenic and additive. A one-step mutation slightly increases resistance.
Each subsequent mutation decreases the target size and, consequently, the frequency of subsequent mutations (Bagirova et al., 2001). The increase in the average resistance of the population after repeated treatments with oligosite fungicide occurs stepwise and gradually. The speed of this process is determined by at least three factors: the frequency of mutation of resistance genes, the coefficient of resistance (the ratio of the lethal dose of a resistant strain in relation to a sensitive one) and the effect of mutations in resistance genes on fitness.
The frequency of occurrence of each subsequent mutation is lower than the previous one; therefore, the process has a damping character (Bagirova et al., 2001). However, if recombination processes (sexual or parasexual) occur in a population, then it is possible to combine different parental mutations in a hybrid strain and accelerate the process. Therefore, panmix populations acquire resistance faster than agamic ones, and in the latter, populations that do not have vegetative incompatibility barriers faster than populations divided by such barriers. In this regard, the presence of strains in populations that differ in the types of mating accelerates the process of acquiring resistance to oligosite fungicides.
The second and third factors do not contribute to the rapid accumulation of dimethomorph-resistant strains in populations. Each subsequent mutation approximately doubles the resistance, which is insignificant, and at the same time reduces both the growth rate in an artificial environment and aggressiveness (Bagirova et al., 2001; Stem, Kirk, 2004). Perhaps this is why there are practically no resistant strains among natural P. infestans strains, even those collected from potato plantings treated with dimethomorph.
A population treated with an oligosite fungicide will also consist of two groups of strains: those that have not been in contact with the fungicide, and therefore have not changed the initial traits (if resistant strains are found among this group, they will not accumulate due to the higher aggressiveness and competitiveness of sensitive strains), and strains in contact with sublethal concentrations of the fungicide. It is among the latter that the accumulation of resistant strains is possible, because here they have advantages over sensitive ones.
Therefore, when using oligosite fungicides, it is not so much a thorough treatment that is important as a high concentration of the drug, several times higher than the lethal dose, because with stepwise mutagenesis, the initial resistance of mutated strains is low.
Finally, mutations in resistance to monosite fungicides are highly expressive, that is, a single mutation can report a high level of resistance up to complete loss of sensitivity. Therefore, the increase in the resistance of populations occurs very quickly.
An example of such fungicides are phenylamides, including the most common fungicide, metalaxyl. Mutations of resistance to it occur with a high frequency, and the degree of resistance in mutants is very high - it exceeds the sensitive strain by a factor of a thousand or more (Derevyagina et al., 1993). Although the growth rate and aggressiveness of resistant mutants decreases against the background of the death of susceptible strains from a systemic fungicide, the number of the resistant population is growing rapidly and, in parallel, its aggressiveness increases. Therefore, after several years of using the fungicide, the aggressiveness of resistant strains can not only equal the aggressiveness of sensitive ones, but also surpass it (Derevyagina, Dyakov, 1992).
Impact on sexual recombination
Since the frequent occurrence of A2 mating type in P. infestans populations coincided with the intensive use of metalaxyl against late blight, it was suggested that metalaxyl induces mating type conversion. In P. parasitica, such a conversion under the action of chloroneb and metalaxyl was experimentally proved (Ko, 1994). A single passage on a medium with a low concentration of metalaxyl led to the emergence of homothallic isolates from a strain of P. infestans sensitive to metalaxyl with mating type A1 (Savenkova and Cherepnikova-Anikina, 2002). During subsequent passages on media with a higher concentration of metalaxyl, not a single isolate of the A2 pairing type was detected, however, most isolates, when crossed with A2 isolates, instead of oospores, formed ugly mycelium accumulations and were sterile. Passages of a resistant strain having the A2 mating type on media with a high concentration of metalaxyl allowed us to detect three forms of mating type changes: 1) complete sterility when crossed with A1 and A2 isolates; 2) homotallism (the formation of oospores in a monoculture); 3) conversion of A2 mating type to A1. Thus, metalaxyl can cause changes in the types of mating in P. infestans populations and, consequently, the occurrence of sexual recombination in them.
Influence on vegetative recombination
Some antibiotic resistance genes increased the frequency of hyphal heterokaryotization and nuclear diploidization (Poedinok and Dyakov, 1981). As noted earlier, heterokaryotization of hyphae during fusion of different strains of P. infestans occurs very rarely due to the phenomenon of vegetative incompatibility in this fungus. However, genes for resistance to some antibiotics can have side effects, expressed in overcoming vegetative incompatibility. This property was possessed by the 1S-1 mutant streptomycin resistance gene. The presence of such mutants in the field populations of phytophthora can increase the flow of genes between strains and accelerate the adaptation of the entire population to new varieties or fungicides.
Certain fungicides and antibiotics can influence the frequency of mitotic recombination, which can also alter genotype frequencies in populations. The widely used fungicide benomyl binds to beta-tubulin, a protein from which microtubules of the cytoskeleton are built, and thereby disrupts the processes of chromosome separation in the anaphase of mitosis, increasing the frequency of mitotic recombination (Hastie, 1970).
The fungicide para-fluorophenylalanine, used to treat Dutch disease in elms, has the same property. Para-fluorophenylalanine increased the frequency of recombination in heterozygous diploids P. infestans (Poedinok et al., 1982).
Cyclic changes in the genotypic composition of populations in the life cycle of P. infestans
The classical developmental cycle of P. infestans in the temperate zone consists of 4 phases.
1) Phase of exponential growth of the population (polycyclic phase) with short generations. This phase usually begins in July and lasts 1,5-2 months.
2) The phase of stopping the growth of the population due to a sharp decrease in the proportion of unaffected tissue or the onset of unfavorable weather conditions. This phase in farms that carry out early pre-harvest leaf removal drops out of the annual cycle.
3) The phase of wintering in tubers, accompanied by a significant decrease in the population size due to accidental infection of tubers, the slow development of infection in them, the absence of re-infection of tubers, rotting and culling of affected tubers under normal storage conditions.
4) The phase of slow development in soil and on seedlings (monocyclic phase), in which the duration of generation can reach a month or more (late May - early July). Usually at this time, diseased leaves are difficult to detect, even with special observations.
Phase of exponential population growth (polycyclic phase)
Numerous observations (Pshedetskaya, Kozubova, 1969; Borisenok, 1969; Osh, 1969; Dyakov, Suprun, 1984; Rybakova, Dyakov, 1990) showed that at the beginning of epiphytoty, low-virulent and slightly aggressive clones predominate, which are subsequently replaced by more virulent and aggressive ones. the rate of growth of the aggressiveness of the population is the higher, the less resistant the variety of the host plant.
As the population grows, the concentration of both selectively important genes introduced into commercial varieties (R1-R4) and selectively neutral (R5-R11) increases. So, in the populations near Moscow in 1993, the average virulence from late July to mid-August increased from 8,2 to 9,4, and the greatest increase was observed for the selectively neutral virulence gene R5 (from 31 to 86% of virulent clones) (Smirnov, 1996 ).
A decrease in the rate of population growth is accompanied by a decrease in the parasitic activity of the population. Therefore, in depressive years, both the total number of races and the proportion of highly virulent races are lower than in epiphytotic ones (Borisenok, 1969). If at the height of epiphytotic weather conditions change to unfavorable for late blight and potato infestation decreases, the concentration of highly virulent and aggressive clones also decreases (Rybakova et al., 1987).
The increase in the frequencies of genes affecting the virulence and aggressiveness of the population may be due to the selection of more virulent and aggressive clones in the mixed population. To demonstrate the selection, a method for the analysis of neutral mutations was developed, which was successfully used in chemostat populations of yeast (Adams et al., 1985) and Fusarium graminearum (Wiebe et al., 1995).
The frequency of mutants resistant to blasticidin S in the field population of P. infestans decreased in parallel with the growth in the aggressiveness of the population, which indicates a change in the dominant clones during the growth of the population (Rybakova et al., 1987).
Wintering phase in tubers
During wintering in potato tubers, the virulence and aggressiveness of P. infestans strains decrease, and the decrease in virulence occurs more slowly than aggressiveness (Rybakova and Dyakov, 1990). Apparently, under conditions conducive to the rapid growth of the population (r-selection), "extra" virulence genes and high aggressiveness are useful, therefore the development of epiphytotics is accompanied by the selection of the most virulent and aggressive clones. In conditions of saturation of the environment, when not the rate of reproduction, but the persistence of existence in unfavorable conditions (K-selection) plays an important role, "extra" genes of virulence and aggressiveness reduce fitness, and clones with these genes are the first to die out, so that the average aggressiveness and the virulence of the population is falling.
Vegetation phase in soil
This phase is the most mysterious in the life cycle (Andrivon, 1995). Its existence is postulated purely speculatively - due to the lack of information about what happens to the pathogen over a long period (sometimes more than a month) - from the emergence of potato seedlings to the appearance of the first spots of the disease on them. On the basis of observations and experiments, the behavior of the fungus in this period of life was reconstructed (Hirst and Stedman, 1960; Boguslavskaya, Filippov, 1976).
Sporulation of the fungus can form on infected tubers in the soil. The resulting spores germinate with hyphae, which can vegetate for a long time in the soil. Primary (formed on tubers) and secondary (on the mycelium in the soil) spores rise to the soil surface by capillary currents, but acquire the ability to infect potatoes only after its lower leaves descend and come into contact with the soil surface. Such leaves (namely, the first spots of the disease are found on them) do not form immediately, but after prolonged growth and development of the potato tops.
Thus, the saprotrophic vegetation phase can also exist in the life cycle of P. infestans. If in the parasitic phase of the life cycle aggressiveness is the most important component of fitness, then in the saprotrophic phase selection is aimed at reducing the parasitic properties, as has been shown experimentally for some phytopathogenic fungi (see Carson, 1993). Therefore, in this phase of the cycle, aggressive properties should be lost most intensively. But so far no direct experiments have been carried out to confirm the above assumptions.
Seasonal changes affect not only the pathogenic properties of P. infestans, but also the resistance to fungicides, which grows in the polycyclic phase (during epiphytoties), and decreases during winter storage (Derevyagina et al., 1991; Kadish and Cohen, 1992). A particularly intense drop in resistance to metalaxyl was observed in the period between the planting of the affected tubers and the appearance of the first spots of the disease in the field.
Intraspecific specialization and its evolution
P. infestans is causing epidemics in two commercially important crops, potatoes and tomato. Epiphytoties on potatoes began soon after the fungus entered new areas. The defeat of tomato was also noted shortly after the appearance of infection on potatoes, but epiphytoties on tomato were noted only a hundred years later - in the middle of the XNUMXth century. Here is what Hallegli and Niederhauser write about the defeat of tomatoes in the USA
(1962): “For about 100 years after the severe epiphytoty of 1845, few or almost no attempts were made to obtain resistant varieties of tomato. Although late blight was first recorded on tomatoes as early as 1848, it did not become the object of serious attention of breeders on this plant until a strong outbreak of the disease in 1946. On the territory of Russia late blight of tomato was registered in the 60th century. “For a long time, researchers did not pay attention to this disease, as it did not cause significant economic damage. But in the 70s and 1979s. XX century epiphytoties of late blight on tomato are observed in the Soviet Union, mainly in the Lower Volga region, Ukraine, the North Caucasus, Moldova ... ”(Balashova, XNUMX).
Since then, tomato blight by late blight has become annual, spread throughout the entire territory of industrial and home cultivation and causes enormous economic damage to this crop. What happened? Why did the first appearance of the parasite on potatoes and the epiphytotic lesion of this crop occur almost simultaneously, and why did it take a century for the epiphytotic to appear on the tomato? These differences support a Mexican rather than a South American source of infection. If the species Phytophthora infestans formed as a parasite of Mexican tuber-bearing species of the genus Solanum, then it is understandable why the cultivated potato belonging to the same section of the genus as the Mexican species was so strongly affected, but due to the absence of co-evolution with the parasite, which did not develop mechanisms of specific and nonspecific resistance.
Tomato belongs to a different section of the genus, the type of its exchange has significant differences from tuberous species, therefore, despite the fact that the tomato is not outside the food specialization of P. infestans, the intensity of its defeat was insufficient for serious economic losses.
The emergence of epiphytoties on a tomato is due to serious genetic changes in the parasite, which increased its fitness (pathogenicity) during parasitism. We believe that the new form specialized for parasitizing the tomato is the T1 race described by M. Gallegly, affecting varieties of cherry tomato (Red Cherry, Ottawa), resistant to the T0 race widespread on potatoes (Gallegly, 1952). Apparently, a mutation (or a series of mutations) that turned the T0 race into the T1 race and led to the emergence of clones highly adapted to defeat tomato. As often happens, an increase in pathogenicity to one host was accompanied by a decrease in it to another, that is, an initial, not yet complete intraspecific specialization arose - to potatoes (race T0) and to tomato (race T1).
What is the evidence for this assumption?
- Occurrence on potatoes and tomatoes. On tomato leaves, the T1 race predominates, while on potato leaves it is rare. According to S.F.Bagirova and T.A. Oreshonkova (unpublished) in the Moscow region in 1991-1992, the occurrence of the T1 race in potato plantings was 0%, and in tomato plantings - 100%; in 1993-1995 - 33% and 90%, respectively; in 2001 - 0% and 67%. Similar data were obtained in Israel (Cohen, 2002). Experiments with the infection of potato tubers with isolates of the T1 race and a mixture of isolates T0 and T1 showed that isolates of the T1 race are poorly preserved in tubers and are replaced by isolates of the T0 race (Dyakov et al., 1975; Rybakova, 1988).
2) Dynamics of race T1 in tomato plantings. Primary infection of tomato leaves is carried out by isolates of the T0 race, which dominate in the analysis of infection in the first spots formed on the leaves. This confirms the generally accepted scheme of the parasite migration: The main mass of infection from potatoes is made up of the T0 race, however, a small number of T1 clones preserved in potatoes, once on the tomato, displace the T0 race and accumulate towards the end of the epiphytotic period. It is also possible that there is an alternative source of infection of tomato leaves with the T1 race, not as powerful as potato tubers and leaves, but constant. Therefore, this source has a weak effect on the genetic structure of the population infecting tomato, but subsequently determines the accumulation of the T1 race (Rybakova, 1988; Dyakov et al., 1994).
3) Aggressiveness to potatoes and tomatoes. Artificial infection of tomato and potato leaves with isolates of races T0 and T1 showed that the former are more aggressive for potatoes than for tomato, and the latter are more aggressive for tomato than for potato. These differences are manifested in the displacement of isolates of a non-“own” race from a mixed population during leaf passages in a greenhouse (D'yakov et al., 1975) and in field plots (Leberton et al., 1999); differences in the minimum infectious load, latency period, size of infectious spots and spore production (Rybakova, 1988; Dyakov et al., 1994; Legard et al., 1995; Forbes et al., 1997; Oyarzun et al., 1998; Leberton et al., 1999; Vega-Sanchez et al., 2000; Knapova, Gisi, 2002; Sussuna et al., 2004).
The aggressiveness of isolates of the T1 race to tomato cultivars lacking resistance genes is so high that these isolates spore on leaves as on a nutrient medium without necrotizing the infected tissue (Dyakov et al., 1975; Vega-Sanchez et al., 2000).
4) Virulence for potatoes and tomatoes. The T1 race affects cherry tomato varieties with the Ph1 resistance gene, while the T0 race is not capable of infecting these varieties, i.e. has a narrower virulence. In relation to differentiators
The R-genes of potatoes are inversely related, i.e. strains isolated from tomato leaves are less virulent than "potato" strains (Table 11).
5) Neutral markers. The analysis of neutral markers in the populations of P. infestans parasitizing on potatoes and tomatoes also testifies to the multidirectional intraspecific selection. In the Brazilian populations of P. infestans, tomato leaf isolates belonged to the clonal line US-1, and those from potato leaves belonged to the BR-1 line (Suassuna et al., 2004). In Florida (USA), since 1994, clone US-90 began to dominate on potatoes (with an occurrence of more than 8%), and clones US-11 and US-17 on tomato, and the latter's isolates are more aggressive for tomato than for potato (Weingartner , Tombolato, 2004). Significant differences in genotype frequencies (DNA fingerprints) in potato and tomato isolates were established for 1200 P. infestans strains collected in the United States from 1989 to 1995 (Deahl et al., 1995).
Using the AFLP method made it possible to separate 74 strains collected from potato and tomato leaves in 1996-1997. in France and Switzerland, in 7 groups. The potato and tomato strains did not clearly differ, but the "potato" strains were genetically more diverse than the "tomato" ones. The former were found in all seven clusters, and the latter, only in four, which indicates a more specialized genome of the latter (Knapova and Gisi, 2002).
6) Mechanisms of isolation. If the populations of the parasite on two host plant species evolve towards narrowing of specialization towards their “own” host, then various pre- and postmeiotic mechanisms arise that prevent interpopulation genetic exchanges (Dyakov and Lekomtseva, 1984).
Several studies have investigated the influence of the source of parental strains on the efficiency of hybridization. When strains isolated from different species of the genus Solanum were crossed in Ecuador (Oliva et al., 2002), it was found that strains with the A2 mating type from wild nightshades (clonal line EC-2) crossed the worst with strains from tomato (line EC -3), and most effectively crossed with the potato strain (EC-1).
All hybrids were found to be non-pathogenic. The authors believe that the low percentage of hybridization and the reduction of pathogenicity in hybrids are due to postmeiotic mechanisms of reproductive isolation of populations.
In the experiments of Bagirova et al. (1998), a large number of potato and tomato strains were crossed with the properties of the T0 and T1 races. The most highly fertile were crosses of T1xT1 strains isolated from tomato (36 oospores in the microscope field of view, 44% of oospore germination), the least effective were crosses of T0xT1 races isolated from different hosts (a low number of developing and germinated oospores, a high proportion of abortive and underdeveloped oospores) ... The efficiency of crosses between isolates of the T0 race isolated from potatoes was intermediate. Since the main body of strains of the T0 race affects potatoes, it has a reliable source of wintering - potato tubers, as a result of which the importance of oospores as wintering infectious units for populations from potatoes is low. The adapted “tomato form” is able to winter on the tomato in the form of oospores (see below) and therefore retains a higher productivity of the sexual process. Due to its high fertility, T1 acquires an independent potential for primary infection in tomato. The results obtained by Knapova et al. (Knapova et al., 2002) can be interpreted in the same way. The crosses of strains isolated from potatoes with strains from tomato gave the highest number of oospores - 13,8 per sq.mm. medium (with a spread of 5-19) and an intermediate percentage of germination of oospores (6,3 with a spread of 0-24). Crossings of strains isolated from tomato yielded the lowest percentage of oospores (7,6 with a spread of 4-12) with the highest percentage of their germination (10,8). The crosses between the strains isolated from potatoes gave an intermediate number of oospores (8,6 with a high scatter of data - 0-30) and the lowest percentage of germination of oospores (2,7). Thus, strains from potatoes are less fertile than those from tomato, but interpopulation crosses gave no worse results than intrapopulation ones. It is possible that the differences with the above data by Bagirova et al. are explained by the fact that Russian researchers worked with strains isolated in the early 90s of the 90th century, and Swiss researchers - with strains isolated in the late XNUMXs.
The basis for low fertility may be the heteroploidy of the strains. If in Mexican populations, where the sexual process and primary infection with oosporous offspring are regular, most of the studied strains of P. Infestans are diploid, then in the countries of the Old World intrapopulation polymorphism of ploidy is observed (di-, tri- and tetraploid strains, as well as heterokaryotic strains with heteroploid nuclei) , and strains having different types of mating, i.e. mutually fertile, differ in nuclear ploidy (Therrien et al., 1989, 1990; Whittaker et al., 1992; Ritch, Daggett, 1995). Diversity of nuclei in antheridia and oogonia can be the reason for low fertility.
As for nuclear exchanges between hyphae during anastomoses, this is prevented by vegetative incompatibility, which splits asexual populations into many genetically isolated clones (Poedinok and Dyakov, 1987; Gorbunova et al., 1989; Anikina et al., 1997b).
7) Convergence of populations. The above data indicate that hybridization between "potato" and "tomato" P. infestans strains is possible. Reciprocal re-infection of different hosts is also possible, albeit with reduced aggressiveness.
A study of population markers in isolates from adjacent potato and tomato fields in 1993 showed that about a quarter of the isolates isolated from tomato leaves were transferred from a neighboring potato field (Dolgova et al., 1997). Theoretically, it could be assumed that the divergence of populations on two hosts would increase and lead to the emergence of specialized intraspecific forms (f.sp. potato and f.sp. tomato), especially since oospores can persist in plant debris (Drenth et al., 1995 ; Bagirova, Dyakov, 1998) and tomato seeds (Rubin et al., 2001). Consequently, tomatoes currently have a source of spring regeneration independent of potato tubers.
However, everything happened differently. Overwintering with oospores allowed the parasite to avoid the narrowest stage in its life cycle - the monocyclic stage of vegetation in the soil, during which parasitic properties decrease, which are gradually restored in the polycyclic phase in summer.
Table 11. Frequencies of virulence genes to potato differentiator varieties in P. infestans strains
Country | Year | Average number of virulence genes in strains | Author | |
from potatoes | from tomato | |||
France | 1995 | 4.4 | 3.3 | Leberton et al., 1999 |
1996 | 4.8 | 3.6 | Leberton, Andrivon, 1998 | |
France, Switzerland | 1996-97 | 6.8 | 2.9 | Knapova, Gisi, 2002 |
USA | 1989-94 | 5 | 4.8 | Goodwin et al., 1995 |
USA, Zap. Washington | 1996 | 4.6 | 5 | Dorrance et al., 1999 |
1997 | 6.3 | 3.5 | " | |
Ecuador | 1993-95 | 7.1 | 1.3 | Oyarzun et al., 1998 |
Israel | 1998 | 7 | 4.8 | Cohen, 2002 |
1999 | 6 | 5.7 | " | |
2000 | 6.7 | 6.1 | " | |
Russia, Mosk. region | 1993 | 8.9 | 6.7 | Smirnov, 1996 |
Russia, different regions | 1995 | 9.4 | 8 | Kozlovskaya and others. |
1997 | 9.2 | 9.2 | " | |
2000 | 8.7 | 4.8 | " |
Primary zoosporangia and zoospores, which germinate oospores, have a high degree of parasitic activity, especially if the oospores were formed parthenogenetically under the influence of pheromones of a strain with the opposite type of mating. Therefore, the infectious material on tomato seedlings grown from seeds infected with oospores is highly pathogenic for both tomato and potato.
These changes led to another population restructuring, expressed in the following important changes from an epidemiological point of view:
- Infected tomato seedlings have become an important source of primary infection of potatoes (Filippov, Ivanyuk, personal messages).
- Epiphytoties on potatoes began to be observed as early as June, about a month earlier than usual.
- In potato plantings, the percentage of the T1 race increased, which was previously encountered there in an insignificant amount (Ulanova et al., 2003).
- Strains isolated from tomato leaves ceased to differ from potato strains in virulence on potato differentiators of virulence genes and began to surpass “potato” strains in aggressiveness not only on tomato, but also on potatoes (Lavrova et al., 2003; Ulanova et al. , 2003).
Thus, instead of divergence, there was a convergence of populations, the emergence of a single population on two host plants with high virulence and aggressiveness to both species.
Conclusion
So, despite more than 150 years of intensive study of P. infestans, in biology, including the population biology of this causative agent of the most important diseases of cultivated solanaceous plants, much remains unknown. It is not clear how the passage of individual stages of the life cycle affects the structure of populations, what are the genetic mechanisms of canalized variability of aggressiveness and virulence, what is the ratio of the reproductive and clonal reproductive systems in natural populations, how vegetative incompatibility is inherited, what is the role of potatoes and tomatoes in the primary infection of these crops and in what is their effect on the structure of parasite populations. So far, such important practical issues as the genetic mechanisms for changing the aggressiveness of the parasite or the erosion of nonspecific potato resistance have not been resolved. With the deepening and expansion of research on potato late blight, the parasite poses new challenges to researchers. However, the improvement of experimental capabilities, the emergence of new methodological approaches to manipulation with genes and proteins allow us to hope for a successful solution of the questions posed.
The article was published in the journal "Potato Protection" (No. 3, 2017)